|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 65 (9164 total) |
| |
ChatGPT | |
Total: 916,913 Year: 4,170/9,624 Month: 1,041/974 Week: 0/368 Day: 0/11 Hour: 0/0 |
Thread ▼ Details |
|
Thread Info
|
|
|
Author | Topic: Rebuttal To Creationists - "Since We Can't Directly Observe Evolution..." | |||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
Kleinman writes: This must be a long, long, long goodbye. No cease and desist disorders and Lenski doesn't understand the thermodynamics of his own experiment. You have no idea what thermodynamics are. For example: AATATGGATATTAGAATATGGATATTTG What is the difference in entropy between those two sequences? You can't seem to answer that basic question.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
Kleinman writes: So when is the brilliant virologist going to give us our next Covid. Another harmless viral infection but this one was created by brilliant virologists. You are an idiot that harms people with your stupidity. Now finding new lies.
|
|||||||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 365 days) Posts: 2142 From: United States Joined: |
Kleinman:Sure drug resistance occurs, but no thanks to jerks like you. Why don't you give a mathematical explanation of why 3 drug combination therapy works for the treatment of HIV? If you have trouble doing that math, read this paper: The mathematics of random mutation and natural selection for multiple simultaneous selection pressures and the evolution of antimicrobial drug resistance
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
Kleinman writes: Sure drug resistance occurs, but no thanks to jerks like you. Why don't you give a mathematical explanation of why 3 drug combination therapy works for the treatment of HIV? I already explained it several times. You just ignore it.
If you have trouble doing that math, read this paper: You are the one getting the math wrong at every turn. You claim that the beneficial mutation rate is 1E9, and you falsely base that on the fixation rate. You also ignore the rate of 1E7 observed in the Lederberg experiment. Even worse, you think you can apply the fixation rate of beneficial mutations in asexual bacteria to sexual eukaryotes. That gets the math so wrong its hilarious.
|
|||||||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 365 days) Posts: 2142 From: United States Joined: |
Kleinman:Taq, the genius virologist thinks that phages cause UCD but can't explain the Kishony and Lenski experiment. He's such a smart virologist that gives us Covid and thinks that 200k retroviral infections do no harm to a germ line cell.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
Kleinman writes: Taq, the genius virologist thinks that phages cause UCD but can't explain the Kishony and Lenski experiment. And I'm done. No reason to respond to the same lies over and over.
|
|||||||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 365 days) Posts: 2142 From: United States Joined: |
Kleinman:Taq will now explain to us entropy even though he knows nothing about thermodynamics and how to do a Markov chain calculation. He's so brilliant.
|
|||||||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 365 days) Posts: 2142 From: United States Joined: |
Kleinman:So which is it, brilliant virologist, is Covid not harmless or 200k retroviral infections not harmless?
|
|||||||||||||||||||||||||||||||||||||||
Theodoric Member Posts: 9202 From: Northwest, WI, USA Joined: Member Rating: 3.4
|
So now the good doctor who could not get into a US medical school is now spamming us with his own "research". Now if he could find a real scientist that supported his papers that would be something.
He truly has no idea how science, the scientific method and peer-reviewed research work. What can be asserted without evidence can also be dismissed without evidence. -Christopher Hitchens Facts don't lie or have an agenda. Facts are just facts "God did it" is not an argument. It is an excuse for intellectual laziness. If your viewpoint has merits and facts to back it up why would you have to lie?
|
|||||||||||||||||||||||||||||||||||||||
Theodoric Member Posts: 9202 From: Northwest, WI, USA Joined: Member Rating: 3.4 |
Who did you submit this paper to for peer review?
What can be asserted without evidence can also be dismissed without evidence. -Christopher Hitchens Facts don't lie or have an agenda. Facts are just facts "God did it" is not an argument. It is an excuse for intellectual laziness. If your viewpoint has merits and facts to back it up why would you have to lie?
|
|||||||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 365 days) Posts: 2142 From: United States Joined: |
Kleinman:So you are both stupid and a liar, you never explained anything, especially not why 3 drug combination therapy works for the treatment of HIV. Kleinman:You keep believing that but 3 drug combination therapy works for the treatment of HIV and you don't know why. And you think that 200k retroviral infections of a germ cell line do no harm. That is so stupid that only Tany could believe it. Do your own examples if you can but I doubt it.
|
|||||||||||||||||||||||||||||||||||||||
AZPaul3 Member Posts: 8564 From: Phoenix Joined: Member Rating: 5.1
|
But he does know that reptiles evolve into birds and fish evolve into mammals because a fossil told him. Lie after lie. You are a fraud, Kleinman. And a damned dumb one at that.
Taq in Message 2038 So says the person who got the math wrong. You falsely concluded that the fixation rate is the same as the rate of adaptive mutations. Let's not even get into your inane lies about the addition rule. You also can't get simple math right, such as your claim that it takes 1E9 replications to get an adaptive mutation but it only took 1E7 replications in the Lederberg experiment.
Taq took you to task. For a self-proclaimed math wiz, you suck at math. You are a fraud, Kleinman.Stop Tzar Vladimir the Condemned!
|
|||||||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 365 days) Posts: 2142 From: United States Joined: |
Kleinman:You were done before you ever started, you don't understand the physics and mathematics of biological evolution. Who wants to hear about 200k viral infections of a germ cell line that does no harm to the cell? And you certainly can't explain the evolution of drug resistance and why cancer treatments fail. All you have contributed is phages make UCD occur. You are brilliant. Kishony and Lenski should include phages in their experiments, they can evolve a virologist.
|
|||||||||||||||||||||||||||||||||||||||
AZPaul3 Member Posts: 8564 From: Phoenix Joined: Member Rating: 5.1 |
You are a fraud, Kleinman.
Stop Tzar Vladimir the Condemned!
|
|||||||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 365 days) Posts: 2142 From: United States Joined: |
Theodoric:This must be the long, long, long, long goodbye. And it is truly easy to pass the medical licensing examinations. That's why Theodoric hasn't done it, it's too easy. And Theodoric is an expert on the evolution of drug resistance and why cancer treatments fail. That's why he wrote the papers that explain the Kishony and Lenski experiments because he's an expert on the scientific method and peer-reviewed research. Of course, he hasn't done any of this, he just makes long, long, long, long goodbyes. He's a dope.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024