|
Register | Sign In |
|
QuickSearch
Thread ▼ Details |
|
Thread Info
|
|
|
Author | Topic: Rebuttal To Creationists - "Since We Can't Directly Observe Evolution..." | |||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Kleinman writes: Tell Kishony and Lenski to use a phage and their experiments will evolve instantly. You still can't address it. I think it proves your claim about 1 adaption per 1 billion replications wrong. Joshua and Esther Lederberg published a hallmark paper in 1951 titled, "Replica Plating and Indirect Selection of Bacterial Mutants", which can be found here: REPLICA PLATING AND INDIRECT SELECTION OF BACTERIAL MUTANTS - PMC Luria and Delbruck went on to explain the processes that undergirded the Lederberg's results which later won Luria and Delbruck a Nobel Prize. There is one interesting observation in the Lederberg paper: "The culutre is fully sensitive to the phage T-1, as well as to streptomycin, and like most E. coli strains gives rise to resistant mutants at rates of approximately 10E-7 and 10E-10 per division, respectively." In this example we saw a beneficial mutation rate of 1 in 10 million and 1 in 10 billion to two different selection pressures using the same strain of E. coli. Kleinman is telling us that one beneficial adaptation every billion divisions is some universal constant, or something of the like. It is so universal that it can even be applied to human evolution. However, in another experiment using E. coli we see beneficial mutation rates that are quite different than what Kleinman claims. If Kleinman's math can't even apply universally to evolution in E. coli, what hope does it have of applying to any other species?
So nobody should use combination therapy for the treatment of HIV, weeds, and insects because Taq says he read it. Now you have to lie about what I have said. I never said those things, and the papers I cited never said those things. Why do you lie on a regular basis? Read the citations. They clearly state that recombination is factor in the evolution of multidrug resistance in HIV. If all you can do is lie about what those papers say, then what does that say about your argument?
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
Kleinman writes: I have, you want me to explain your reference and I tell you to explain how a phage makes UCD possible. Right, you are avoiding it. Here it is again. I think it proves your claim about 1 adaption per 1 billion replications wrong. Joshua and Esther Lederberg published a hallmark paper in 1951 titled, "Replica Plating and Indirect Selection of Bacterial Mutants", which can be found here: REPLICA PLATING AND INDIRECT SELECTION OF BACTERIAL MUTANTS - PMC Luria and Delbruck went on to explain the processes that undergirded the Lederberg's results which later won Luria and Delbruck a Nobel Prize. There is one interesting observation in the Lederberg paper: "The culutre is fully sensitive to the phage T-1, as well as to streptomycin, and like most E. coli strains gives rise to resistant mutants at rates of approximately 10E-7 and 10E-10 per division, respectively." In this example we saw a beneficial mutation rate of 1 in 10 million and 1 in 10 billion to two different selection pressures using the same strain of E. coli. Kleinman is telling us that one beneficial adaptation every billion divisions is some universal constant, or something of the like. It is so universal that it can even be applied to human evolution. However, in another experiment using E. coli we see beneficial mutation rates that are quite different than what Kleinman claims. If Kleinman's math can't even apply universally to evolution in E. coli, what hope does it have of applying to any other species?
Don't be silly, you are the one claiming that recombination makes combination therapy fail. That is a lie. It is the authors of peer reviewed papers that are saying recombination is an important factor for developing multidrug resistance in HIV.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
Kleinman writes: Taq then brings up an example of koalas and retroviruses, and it is ruining their immune system and possibly driving them to extinction. Yes, it is an example of a circulating retrovirus producing endogenous retroviruses, something you claim can't happen. Reality trumps your empty claims.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
Kleinman writes: So the only example you could come up with is making the koalas sick by destroying their immune system and possibly driving them to extinction. That's all I need to counter your lie that retroviruses can't produce ERV's.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
Kleinman writes:
So you aren't going to explain how a phage makes UCD possible. Another liar for Jesus.
Then have them explain why combination therapy works for treating HIV, weeds, and insects, because you certainly can't explain. All I need to do is cite these papers to counter your lie that recombination plays no part in drug resistance in HIV.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Dredge writes: Tany is just being a good Darwinist ... a good Darwinist ignores any evidence that doesn't conform to Darwinist dictrine. You would have to present that evidence first before accusing people of ignoring it. I showed Kleinman an experiment where the rate of beneficial adaptations was 1 in 10 million replications. Look at how he can't even address it, and then continues to claim that the rate is 1 in 1 billion, no matter what. Look at the lies you peddled from the Discovery Institute dealing with ERV's.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
Kleinman writes: Yeah, your argument makes real sense, only 199,999 retroviral infections to go. And continuing with the lie. Go figure.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
Kleinman writes: Sure you can, that's why you post all zero of these links that explain how drug resistance evolves and why cancer treatments fail. You ran away from all of the posts where I cited papers on the evolution of drug resistance.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Kleinman writes: What discussion have I gotten from the mathematician that doesn't do the mathematics of biology? Zero. He knows nothing about the physics and mathematics of biological competition, descent with modification, and recombination. But he does know that reptiles evolve into birds and fish evolve into mammals because a fossil told him. So says the person who got the math wrong. You falsely concluded that the fixation rate is the same as the rate of adaptive mutations. Let's not even get into your inane lies about the addition rule. You also can't get simple math right, such as your claim that it takes 1E9 replications to get an adaptive mutation but it only took 1E7 replications in the Lederberg experiment.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Kleinman writes: This must be a long, long, long goodbye. No cease and desist disorders and Lenski doesn't understand the thermodynamics of his own experiment. You have no idea what thermodynamics are. For example: AATATGGATATTAGAATATGGATATTTG What is the difference in entropy between those two sequences? You can't seem to answer that basic question.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
Kleinman writes: So when is the brilliant virologist going to give us our next Covid. Another harmless viral infection but this one was created by brilliant virologists. You are an idiot that harms people with your stupidity. Now finding new lies.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Kleinman writes: Sure drug resistance occurs, but no thanks to jerks like you. Why don't you give a mathematical explanation of why 3 drug combination therapy works for the treatment of HIV? I already explained it several times. You just ignore it.
If you have trouble doing that math, read this paper: You are the one getting the math wrong at every turn. You claim that the beneficial mutation rate is 1E9, and you falsely base that on the fixation rate. You also ignore the rate of 1E7 observed in the Lederberg experiment. Even worse, you think you can apply the fixation rate of beneficial mutations in asexual bacteria to sexual eukaryotes. That gets the math so wrong its hilarious.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Kleinman writes: Taq, the genius virologist thinks that phages cause UCD but can't explain the Kishony and Lenski experiment. And I'm done. No reason to respond to the same lies over and over.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Creationists talking about thermodynamics often reminds me of babies pounding on a keyboard thinking they are doing something amazing on the computer.
Kleinman's misguided view of thermodynamics has led him to the conclusion that going from a very simple single celled replicator to all of the biodiversity we see today is an increase in entropy. His claim is that sequences evolve through a Markov process so that genetic diversity increases over time. He believes this increase in genetic diversity is an increase in entropy. He treats bases in a DNA strand as positions in a system, and then claims entropy has increased if different strands have different bases at the same location. This has no real meaningful tie to the actual laws of thermodynamics. At best, there are ties to entropy in Shannon information, which isn't thermodynamics. The real thermodynamics is occurring at the biochemical level, the actual template driven replication of DNA. The flow of energy from the environment through the metabolism of life is where the actual thermodynamic processes exist.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Kleinman writes: Kleinman refers to the thermodynamics of descent with modification, though he never explains what he means by that. Descent with modification is whatever he needs it to be at any given moment. It has no definition, and never will.
So how is the thermodynamics of descent supposed to differ depending on whether there is modification or not? Of course, that last question begs the question of whether there can possibly be descent without modification. To have descent without modification the offspring would have to be genetically identical to their parents. In Kleinman's world, mutations are increases in entropy. Of course, going from base elements and simple molecules to DNA is a net decrease in entropy, so not sure how the sequence itself is supposed to offset that decrease in entropy. The mere act of copying DNA is a net decrease in entropy before we even get to the sequence. Of course, it all depends on how you define the system. If we include all of the Earth and the Sun we will continually see a net increase in entropy, but this is true for all planets, including those that don't have life or DNA.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024