Rebuttal To Creationists - "Since We Can't Directly Observe Evolution..."

Your floundering is obvious.

Kleinman:

---

Oh, I see, there were millions of adaptive mutations, they just didn't fix.

Taq:

---

Isn't that what you have been arguing the whole time? You have been arguing that clonal interference occurs which can only drive one adaptive mutation to fixation which driving lesser adaptive mutations to extinction.
​
And you still don't have an explanation for the Lederberg experiment.

---

---

That's what happens, and that's what happened in the Lenski experiment. You explain the Lederberg experiment if you think it proves UCD.

Kleinman:

---

When you brought up Markov chains, I suggested that you do a real example, the Kishony experiment. Then you plop down some speculative example. You can't do a Markov chain of a real example.

Taq:

---

If you can't find the relative difference in entropy between two sequences then what hope do you have of doing the same for the multiple sequences produced by a Markov process?

---

---

You don't know how to do a Markov calculation.

Then by your own admission there would have been adaptive mutations that didn't fix. Therefore, you can't use the fixation rate to determine the beneficial mutation rate. I never said that the Lederberg experiment proves UCD. What are you talking about?Can you or can you not explain the results of the Lederberg experiment? This is a simple case of evolution in E. coli to a single environmental challenge. Can you explain it?

You don't know how to do measurements of entropy.

Tanypteryx:

---

Your floundering is obvious.

---

Foundering is what you do when I ask you simple questions about ERVs.

Kleinman:

---

You don't know how to do a Markov calculation.

Taq:

---

You don't know how to do measurements of entropy.

---

---

Sure I do, but you don't need to. You only need to be able to compute the occurrence of a single adaptive mutation in a single selection pressure environment or two adaptive mutations in a two selection pressure environment, or three adaptive mutations in a three selection pressure environment,...

That's strange. I gave you a pretty decent rundown of the ERV evidence and you didn't have a response.

Nope, it was obvious that you would just keep asking questions (Gish Gallop) that were completely unrelated to the patterns of ERVs in the primate genomes. You still have absolutely no explanation for the patterns and that became completely obvious after Taq posted detailed descriptions.

You need to.TTTCTATAGTCCTTGAGAGGAGGAGTCGTC
TTTCTAGAGTCCTTGAGAGGAGGAGTCGTC
​
They differ by a G:T early in the sequence. Which of these has lower entropy, and why? Let's take a look at the sickle cell trait. In regions with endemic malaria this is an adaptive mutation. However, in regions without malaria the side effects of sickle cell anemia make the mutation non-adaptive. So how is the same mutation an increase in entropy in one environment and a decrease in entropy in another?

quote:

---

Nope, that's all I'm assuming.

---

Well it seems very confused. Aside from mixing up alleles and genomes you need some explanation of how you can have C at both loci. A recent gene duplication?

quote:

---

Nope, I only assume that whatever gene is at a given locus, is homogenous. You assume they are not homogenous.

---

I certainly did not make any such assumption. But just to make you happy I will write it out again with homozygosity explicitly assumed,If one locus has alleles A and C (and no others) and the other has B and D and all individuals are homozygous, the frequencies of AA and CC must sum to 1. Adding the frequency of BB is pointless. (Indeed, if no individual has AA and BB the overlap of BB and CC must be every individual with BB).

Science does not deal in proof. It deals in evidence.

I have not been closely monitoring this thread. I am a history, philosophy, literature guy, so the hard science is a slog at times to follow.Did he ever show any understanding of the difference between asexual and sexual reproduction?

Kleinman:

---

So you think that the Kishony and Lenski experiments don't show that it takes a billion replications for each adaptive mutation?

Taq:

---

I'm not seeing any such calculation in those papers. Can you show me what I missed?
​
This is the Kishony paper I am working from:
Spatiotemporal microbial evolution on antibiotic landscapes - PMC
​
On top of that, why does the Lederberg paper say that it only takes 10 million divisions to get phage resistance? You never seem to answer that question. Don't you know how evolution works? Why can't you explain how evolution works in the Lederberg experiment?

---

---

Of course, you won't see any calculations in the Kishony paper. They are only vaguely talking about descent with modification such as with this quote:

quote:

---

The large size of the plate serves two purposes: it provides for a large population and mutational supply, and it maintains the antibiotic gradient despite diffusion (since drug diffusion time scales quadratically with distance while the bacterial front advances linearly, the large plate size prevents the antibiotic gradient from equilibrating over the duration of the experiment).

---

They know they need large populations and the evolutionary process needs to occur before the drug has a chance to diffuse across the region. I'm giving the mathematics that quantifies the population. Likewise, Lenski actually counts his populations and measures the number of adaptive mutations. That's why we know it takes about a billion replications for each adaptive mutation.As far as the Lederberg example goes, that's your argument. If you think that it proves UCD, you make the argument. Do you think that a phage gives humans an evolutionary advantage over chimps? I think you don't understand your own example.

Kleinman:

---

Your training certainly hasn't prepared you to understand the laws of thermodynamics and you math skills are zero.

Taq:

---

Given your inability to do basic math, I don't feel that worried by your opinion.

---

---

At least I understand how to use the addition rule for mutually exclusive subsets and for arbitrary subsets, and how to do the mathematics for the Kishony and Lenski experiments and you don't. When are you going to learn how to do the mathematics of descent with modification and recombination? It's the stochastic portion of evolution that you don't get.

Kleinman:

---

If you were honest you would recognize all the differences, instead, you only see similarities and from that you jump to the conclusion that they are all related.

Taq:

---

The differences are recognized in the phylogenies. Didn't you know that?
​
It is the pattern of both similarities and differences that points to UCD. Those differences fit into a tree-like pattern, and it is that pattern which points to UCD.

---

---

The mechanisms of evolutionary transition don't account for these differences. Don't you see that bacteria are not related to humans at the very least?