|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 66 (9164 total) |
| |
ChatGPT | |
Total: 916,469 Year: 3,726/9,624 Month: 597/974 Week: 210/276 Day: 50/34 Hour: 1/5 |
Thread ▼ Details |
|
Thread Info
|
|
|
Author | Topic: Problems with Mutation and the Evolution of the Sexes | |||||||||||||||||||||||
Blue Jay Member (Idle past 2719 days) Posts: 2843 From: You couldn't pronounce it with your mouthparts Joined: |
Hi, Godservant! Welcome to EvC!
godservant writes: I mean, if a simple cell can all of a sudden appear out of a blob of goo, then shouldn't we or some very intelligent scientist somewhere be able to create a living cell out of nothing but let's say, a blob of goo?? Does the possession of intelligence automatically bestow upon you all knowledge? Of course not. There is a phenomenon called "constraint": you can only work with the tools you have available to you. We obviously don't have the tools (or the knowledge) available to us to create a cell from a blob of goo. But, we're working on that; sooner or later, "some very intelligent scientist somewhere" will do it. However, like all knowledge, it takes time, even for "some very intelligent scientist," to find it. Side Note: this is off-topic here. I probably shouldn't have responded, but I didn't want to leave it hanging. You should read the Forum Guidelines: they enforce those here. Maybe you could propose a new topic for this (in the forum labelled "Proposed New Topics" under "Board Administration"). I think this topic has probably been discussed before, so you can look through the archives for it, then decide if you have enough remaining issues to start a new topic. Have fun here at EvC! I'm Bluejay Darwin loves you.
|
|||||||||||||||||||||||
godservant Junior Member (Idle past 5842 days) Posts: 24 Joined: |
//Have a look at the sex-lifes of ciliates such as Paramecium. Is that sexual reproduction? Are they hermaphrodites? Do they have sexes? Note that they are single-celled.
Now consider the F plasmid in E. Coli ...// Alright, so why were they left behind in the wake of mass evolution?
|
|||||||||||||||||||||||
Blue Jay Member (Idle past 2719 days) Posts: 2843 From: You couldn't pronounce it with your mouthparts Joined: |
Click the "Peek" button at the bottom of this message to see the dBcodes I'm using.
You can quote prior message like this:
Some Person writes: I'm quoting Some Person! Other quotes can be done like this:
quote: Using these makes it easier for people to see what you're responding to and what you're writing yourself. Now, addressing your post:
godservant writes: We self-replicate imperfectly, culminating in a perfect replication?? He didn't say this: please read more carefully. He said our reproductive processes are imperfect, which means mutations (i.e. changes) happen.
godservant writes: But then again, we are no longer a replication of the original being but a completely different mass of tissue with functions that just happened to perfectly form. A mutation causes something like hair color to change. Over long periods of time, the effects can accumulate. There isn't just a random smattering of traits thrown together to form the offspring: most of the genome is conserved when passed from parent to offspring. P.S. These messages are all quite old now: you probably shouldn't go through and respond to them one by one like this. I'm Bluejay Darwin loves you.
|
|||||||||||||||||||||||
godservant Junior Member (Idle past 5842 days) Posts: 24 Joined: |
A mutation causes something like hair color to change. Over long periods of time, the effects can accumulate. There isn't just a random smattering of traits thrown together to form the offspring: most of the genome is conserved when passed from parent to offspring. physical features such as hair colour, body type, sex, features all inherited by the parent. A mutation as you refer to it is a change from the parental genetic inheritance forming another characteristic not normal. By what we know today and have observed of genetic mutations is that in the majority of cases, the mutation causes a loss of genetic information that is usually detrimental to the individual and any consecutive replications of that genetic information passed down to offspring, usually starts a downward spiral, not an upward spiral. Definition of mutation: American Heritage Dictionary - Cite This Source - Share This mu·ta·tion Audio Help (my-t'shn) Pronunciation Keyn. The act or process of being altered or changed. An alteration or change, as in nature, form, or quality. Genetics A change of the DNA sequence within a gene or chromosome of an organism resulting in the creation of a new character or trait not found in the parental type. The process by which such a change occurs in a chromosome, either through an alteration in the nucleotide sequence of the DNA coding for a gene or through a change in the physical arrangement of a chromosome. A mutant.
|
|||||||||||||||||||||||
lyx2no Member (Idle past 4738 days) Posts: 1277 From: A vast, undifferentiated plane. Joined: |
TGTGACGTCTGACGTTGCGTAGTACGTACTGACTACGCTGAGTACGTACGTGA
TGTGACGTCTGACGTTGCGTAGTATGTACTGACTACGCTGAGTACGTACGTGA Good morning godservant: One of the above is a mutation of the other. Using your theory of “Mutations Only Cause a Lose of Information” can you sort out which one is the original? It should, after all, have more information. Edited by lyx2no, : because I can. Kindly I've been off doing my bit to save the world, and it totally sucked.
|
|||||||||||||||||||||||
Dr Adequate Member (Idle past 306 days) Posts: 16113 Joined: |
By what we know today and have observed of genetic mutations is that in the majority of cases, the mutation causes a loss of genetic information that is usually detrimental to the individual and any consecutive replications of that genetic information passed down to offspring, usually starts a downward spiral, not an upward spiral. And we also know that detrimental mutations are less likely to undergo "consecutive replications of that genetic information", 'cos of the law of natural selection. Maybe there's only one beneficial mutation for every thousand harmful mutations, but it's the beneficial mutation that's going to spread through the gene pool. Edited by Dr Adequate, : No reason given.
|
|||||||||||||||||||||||
Dr Adequate Member (Idle past 306 days) Posts: 16113 Joined: |
[qs]//Have a look at the sex-lifes of ciliates such as Paramecium. Is that sexual reproduction? Are they hermaphrodites? Do they have sexes? Note that they are single-celled.
Now consider the F plasmid in E. Coli ...// Alright, so why were they left behind in the wake of mass evolution?[/quote] Paramecium and E. coli are still flourishing: there are more E. coli in your gut than there are humans on this planet. They were not left behind. There is also no such thing as "mass evolution". One lineage evolving in a certain way doesn't magically make all the other lineages evolve in the same way. In particular, Paramecium and E. coli have evolved alternatives to sexual reproduction as we understand it. By the way, did you do what my post suggested and look them up? I bet you didn't.
|
|||||||||||||||||||||||
Dr Adequate Member (Idle past 306 days) Posts: 16113 Joined: |
"Specifically, we self-replicate imperfectly. As did the first forms of life. It's these imperfections in the copying process that allow mutation and evolution to occur - otherwise all life would simply be cloned duplicates of the first life form." Ok, I read up to this part and I had to laugh. Sorry, but which part of this sentence makes sense to you?? All of it. Which part of it go you object to?
Do you guys ever seriously believe what you say?? Or do you even bother to read what you say?? Yes, and yes. Also, geneticists agree with what we say, or to be more accurate, we agree with them. So when you find that all the geneticists in the world agree with a statement about genetics, and it makes you, a non-geneticist, laugh, then perhaps you should spend a few minutes thinking about who's wrong about genetics: you or the geneticists. Edited by Dr Adequate, : No reason given.
|
|||||||||||||||||||||||
godservant Junior Member (Idle past 5842 days) Posts: 24 Joined: |
Not according the the laws of entrophy and thermodynamics
|
|||||||||||||||||||||||
godservant Junior Member (Idle past 5842 days) Posts: 24 Joined: |
So our guts would have had to have been there since the beginning for them to even have come to existance and flourish. What would the bacteria have been when in the state of evolution had not all the genetic information already been there? What would have been it's simplest form in the beginning allowing it to function, thrive and reproduce had it also had to evolve from lesser ingredients?
|
|||||||||||||||||||||||
Chiroptera Inactive Member |
Hi, godservant.
I have my degrees in physics and mathematics. If you are having some difficulty with thermodynamics and entropy, then I might be able to help you out. In fact, I just checked and my thermodynamics text books are right on the shelf across the room. Ask away! Speaking personally, I find few things more awesome than contemplating this vast and majestic process of evolution, the ebb and flow of successive biotas through geological time. Creationists and others who cannot for ideological or religious reasons accept the fact of evolution miss out a great deal, and are left with a claustrophobic little universe in which nothing happens and nothing changes. -- M. Alan Kazlev
|
|||||||||||||||||||||||
godservant Junior Member (Idle past 5842 days) Posts: 24 Joined: |
"Specifically, we self-replicate imperfectly. As did the first forms of life. It's these imperfections in the copying process that allow mutation and evolution to occur - otherwise all life would simply be cloned duplicates of the first life form." Ok, I read up to this part and I had to laugh. Sorry, but which part of this sentence makes sense to you?? the problem is, if we are the most perfect form of the evolutionary process, having the voluntary and involuntary mechanisms and consciousness and intelligence that we didn't have in the beginning, how can consecutive imperfections lead to such perfection as we now have (being as perfect as perfect can be at this present time). When considering the law of entrophy, this simply is absurd to believe such a thing!!
|
|||||||||||||||||||||||
godservant Junior Member (Idle past 5842 days) Posts: 24 Joined: |
The law of entropy suggests a decay of things over time and the law of thermodynamics speaks of a transfer of energy from one form to another.
We see entropy all around us, everything decays overtime. The law of thermodynamics suggest that you cannot transfer more energy than is produced or remaining in the subject transfering that energy. Therefore, to transfer enough energy to something for it to create something requiring more energy than the thing transfering can produce is unlikely. A cell can only produce enough energy to produce another cell. Genetic information in that cell is what determines what kind of cell it will create. A liver cell will produce other liver cells, brain cells produce other brain cells. flagellum produce other flagellum, bacteria produce other bacteria, virus' produce other virus'. Nothing has changed under the sun. Whenever a mutation in a human or animal occurs, it's ALWAYS a loss of genetic information. As far as the nylon eating bacteria is concerned, no new information was added, only a change in the current information. Whether it was beneficial to it or not is irrelevant. Had it mysteriously grown another eye or wings or a second stomach would prove new genetic information. Virus' swap information all the time. It does not add new information, it is just a change in the current information in the DNA. Just as humans can have a change in information that allows them to become immune to certain virus' and diseases, so also the virus can change current information to allow for the same ability. When you see a virus become a parasite, then you will see perhaps an addition of new information not previously there.
|
|||||||||||||||||||||||
Granny Magda Member Posts: 2462 From: UK Joined: Member Rating: 3.8 |
Hi godservant, welcome to EvC,
the problem is, if we are the most perfect form of the evolutionary process Woah! Let me stop you right there. We are not perfect. Even a casual inspection of my dodgy short-sighted eyes, or the failing kidneys that nearly cost me my life should tell you that. Also, perfection requires some kind of standard against which it can be measured. Evolution has no such standard. Natural selection does not require that an organism be perfect, only that it is just good enough to get by. Perfection is a human conceit, which does not exist in the real world. I'm sure that it is very reassuring for you to consider yourself to be "as perfect as perfect can be", but I am afraid that this is just a delusion of yours, with no relevance to evolution. Sorry. Added by Edit: By the way, whoever told you that the process of evolution breaks the second law of thermodynamics was (I'm being charitable here) mistaken. The second law only refers to a closed system. The earth is not a closed system, since it constantly receiving energy from the sun, a constant source of input. Here is a page that explains this in more detail. I suggest that you take a look and that you assess the source of this claim about the second law more critically in future. Edited by Granny Magda, : Added last bit. Mutate and Survive
|
|||||||||||||||||||||||
godservant Junior Member (Idle past 5842 days) Posts: 24 Joined: |
My point being we are at the current apex of our genetic informational abilities. Whether in the future sometime we acquire new genetic information making us better than we are now, remains to be seen. But by evolutionist argumentation, we came from something lesser than what we are now. There's no indication that evolutionists believe otherwise, otherwise we would have been more perfect in the past, losing genetic information to become lesser than what we once were. Which would prove the process of entropy and not evolution and "survival of the fittest", unless the fittest are the lesser beings.
But then again, it seems the more we learn and proclaim to be wise, the dumber we become.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024