Register | Sign In


Understanding through Discussion


EvC Forum active members: 65 (9162 total)
3 online now:
Newest Member: popoi
Post Volume: Total: 915,817 Year: 3,074/9,624 Month: 919/1,588 Week: 102/223 Day: 13/17 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Evolutionary Adaptation
Someone who cares
Member (Idle past 5751 days)
Posts: 192
Joined: 06-06-2006


Message 76 of 115 (319781)
06-09-2006 10:17 PM
Reply to: Message 72 by RAZD
06-09-2006 10:09 PM


So there is nothing that prevents it.
The preset genetic code would not allow it.
And when the code of the offspring is different from the code of either parent where did that come from? The parents with mutation. Thus there is no barrier to the code changing over time from generation to generation.
The parents each gave half of their code, this recombined, there we have it, code for the offspring.
I've written lots of computer code where previous code was copied and one or two modifications were made to arrive at a different result.
Mutations change the code. It's that simple, it's that basic, it's that undeniable.
Mutations do alter the code, slightly. But they do not alter it in a way that would make evolution happen. Have you read my essay yet?
But that is change in species over time, change within "kind" if you will for they were horses before they had only one hoof.
And once again -- your OPINION has no effect on the reality around you.
Enjoy.
It's not just opinion, it's backed up beliefs. I have reason to believe what I believe in.

"If you’re living like there is no God you’d better be right!" - Unknown

This message is a reply to:
 Message 72 by RAZD, posted 06-09-2006 10:09 PM RAZD has replied

Replies to this message:
 Message 79 by RAZD, posted 06-09-2006 10:28 PM Someone who cares has not replied

  
RAZD
Member (Idle past 1405 days)
Posts: 20714
From: the other end of the sidewalk
Joined: 03-14-2004


Message 77 of 115 (319782)
06-09-2006 10:18 PM
Reply to: Message 74 by Someone who cares
06-09-2006 10:13 PM


But the 9 never existed before, where did you get it from?
It's an upside-down 6.
That's how simple it is.

Join the effort to unravel {AIDSHIV} with Team EvC! (click)

we are limited in our ability to understand
by our ability to understand
RebelAAmerican.Zen[Deist
... to learn ... to think ... to live ... to laugh ...
to share.

This message is a reply to:
 Message 74 by Someone who cares, posted 06-09-2006 10:13 PM Someone who cares has not replied

  
arachnophilia
Member (Idle past 1344 days)
Posts: 9069
From: god's waiting room
Joined: 05-21-2004


Message 78 of 115 (319784)
06-09-2006 10:19 PM
Reply to: Message 74 by Someone who cares
06-09-2006 10:13 PM


But you, are an intelligent being. You are conscience and smart when you do that. But evolution is supposed to be unguided, and random, without direction...
no, not exactly. the words i italicized above were intentional. evolution has a random component, yes: variation. but the other component, selection is not random. it is based (in nature) on fitness and sexual factors. we can also artificially control it, ourselves. selection can be, and often is, an intelligent process.
But the 9 never existed before, where did you get it from?
i added one.
here's a better example, if you'd like:
GACTGCGATAGCTAGCTAGA
becomes
GACTGGCGATAGCTAGCTAGA
becomes:
GACTGACGATAGCTAGCTAGA
where did the extra G come from? duplication. where did the A come from? variation. duplication + variation = "new" data.


This message is a reply to:
 Message 74 by Someone who cares, posted 06-09-2006 10:13 PM Someone who cares has not replied

  
RAZD
Member (Idle past 1405 days)
Posts: 20714
From: the other end of the sidewalk
Joined: 03-14-2004


Message 79 of 115 (319791)
06-09-2006 10:28 PM
Reply to: Message 76 by Someone who cares
06-09-2006 10:17 PM


The preset genetic code would not allow it.
HOW???
You can't just keep saying this as if that alone prevents anything from happening. This is just assertion after assertion after assertion of the same ignorance and incredulity -- and NOT A SINGLE PIECE OF EVIDENCE.
The parents each gave half of their code, this recombined, there we have it, code for the offspring.
But it doesn't always happen that way. Sometimes you get more from one than the other, sometimes you get duplications of whole chromosomes.
You also have mutations that the offspring gets from badly copied code that results in code neither parent had.
You are just plain absolutely wrong that it is so limited, and the evidence can be found in any real study of genetics.
Mutations do alter the code, slightly. But they do not alter it in a way that would make evolution happen.
So you SAY without any evidence to substantiate it and in spite of evidence to the contrary. Speciation has been observed in many situations, and the genetic reasons for these speciations have been studied. Guess what? They are caused by mutations in the genetic code of the species involved.
You
Are
Wrong.
Again.
Have you read my essay yet?
Yes, and I found it boring, full of misrepresentations and false claims, with unsubstantiated assertion piled on unsubstantiated assertion. An argument from incredulity and ignorance with many careless PRATTS that any serious study would have uncovered beforehand. Like your arguments here.
Enjoy.
ps added by edit
It's not just opinion, it's backed up beliefs.
What a logical HOWLER! Beliefs are not evidence. Furthermore what you said in effect is:
It's not just opinion (what you think is true) it's backed up by belief (what you think is true).
ROFLOL.
Edited by RAZD, : added ps

Join the effort to unravel {AIDSHIV} with Team EvC! (click)

we are limited in our ability to understand
by our ability to understand
RebelAAmerican.Zen[Deist
... to learn ... to think ... to live ... to laugh ...
to share.

This message is a reply to:
 Message 76 by Someone who cares, posted 06-09-2006 10:17 PM Someone who cares has not replied

  
kuresu
Member (Idle past 2513 days)
Posts: 2544
From: boulder, colorado
Joined: 03-24-2006


Message 80 of 115 (319798)
06-09-2006 10:57 PM
Reply to: Message 58 by Someone who cares
06-09-2006 9:45 PM


you missed it. I didn't give you all the transitionals. had I done it using arachniphilia's method, I would have shown you 603 posts, with a single letter change, if not more, and I would arrive at the new message, or a different one. If done by 10 characters, it would take at least 61 generations of mutations. If done by a hundred per, it would take at least 7 generations. I didn't, becuase I'm not going to spend the next week writing them out. Mutations work like this (at least base-pair subsitutions), and that is how, with many little steps, you can end up in with something different.
Oh, and are you going to reply to my disection of your essay? The post is one the evolution logic thread.

All a man's knowledge comes from his experiences

This message is a reply to:
 Message 58 by Someone who cares, posted 06-09-2006 9:45 PM Someone who cares has not replied

  
Lithodid-Man
Member (Idle past 2931 days)
Posts: 504
From: Juneau, Alaska, USA
Joined: 03-22-2004


Message 81 of 115 (319806)
06-09-2006 11:13 PM
Reply to: Message 66 by Someone who cares
06-09-2006 9:58 PM


Re: Can't leave this one alone
That's what meiosis is? The combination of genetic code from parents to form the code of the offspring? Are you sure? Meiosis? Hmmm...
No, but it starts from meiosis. Meiosis divides the chromosome number in half. Then the combination takes place. Sorry for any confusion, I thought it's quite obvious.
Ain't Google great? Look it up in seconds so it looks like you knew all along. Wonderful invention, that.

Doctor Bashir: "Of all the stories you told me, which were true and which weren't?"
Elim Garak: "My dear Doctor, they're all true"
Doctor Bashir: "Even the lies?"
Elim Garak: "Especially the lies"

This message is a reply to:
 Message 66 by Someone who cares, posted 06-09-2006 9:58 PM Someone who cares has not replied

  
crashfrog
Member (Idle past 1467 days)
Posts: 19762
From: Silver Spring, MD
Joined: 03-20-2003


Message 82 of 115 (319807)
06-09-2006 11:16 PM
Reply to: Message 47 by Someone who cares
06-09-2006 8:54 PM


But the point is, no new information can be added that would be for cells, tissues, organs, systems, body parts, etc, that the organism doesn't already have.
I don't get why you think this is the case. Information is often added during the generation of gametes by meiosis. Mutations occur that are not corrected. Changes happen that are not undone. Information decends to the offspring that did not come from the parent.
These aren't articles of faith, or something; these are direct observations of meiosis.

This message is a reply to:
 Message 47 by Someone who cares, posted 06-09-2006 8:54 PM Someone who cares has not replied

  
Crue Knight
Inactive Member


Message 83 of 115 (320381)
06-11-2006 1:00 AM
Reply to: Message 60 by Someone who cares
06-09-2006 9:47 PM


quote:
So, they please the world instead of standing tall for the truth?
Yeah, pretty much trying to please both sides. But it doesn't work that way. If one is right then the other is wrong.

Read "Time Has an End" by, H. Camping for great evdence that the Bible is true and the word of God. You can read it online at Time Has An End

This message is a reply to:
 Message 60 by Someone who cares, posted 06-09-2006 9:47 PM Someone who cares has not replied

Replies to this message:
 Message 86 by RAZD, posted 06-11-2006 9:34 PM Crue Knight has replied

  
Crue Knight
Inactive Member


Message 84 of 115 (320386)
06-11-2006 1:11 AM
Reply to: Message 24 by jar
06-08-2006 9:05 AM


Re: why Goddidit is so useless as an explanation
Sure could, and if that were true, if GOD actually did do that, then we need to abandon science and return to magic.
We cant explain how God created the animals and planets. There's no science in that. So all we can say is God did it. He spoke it, but we dont know how it all happened, because He is so much greater than us we dont understand how He is.

Read "Time Has an End" by, H. Camping for great evdence that the Bible is true and the word of God. You can read it online at Time Has An End

This message is a reply to:
 Message 24 by jar, posted 06-08-2006 9:05 AM jar has replied

Replies to this message:
 Message 85 by jar, posted 06-11-2006 1:14 AM Crue Knight has not replied
 Message 88 by ramoss, posted 06-12-2006 8:48 AM Crue Knight has replied

  
jar
Member (Idle past 394 days)
Posts: 34026
From: Texas!!
Joined: 04-20-2004


Message 85 of 115 (320388)
06-11-2006 1:14 AM
Reply to: Message 84 by Crue Knight
06-11-2006 1:11 AM


Re: why Goddidit is so useless as an explanation
We cant explain how God created the animals and planets. There's no science in that. So all we can say is God did it. He spoke it, but we dont know how it all happened, because He is so much greater than us we dont understand how He is.
Perhaps you cannot explain how God created the animals and planets, but that does not mean that the rest of us can't. GOD does not ask us to check our brains at the door.

Aslan is not a Tame Lion

This message is a reply to:
 Message 84 by Crue Knight, posted 06-11-2006 1:11 AM Crue Knight has not replied

  
RAZD
Member (Idle past 1405 days)
Posts: 20714
From: the other end of the sidewalk
Joined: 03-14-2004


Message 86 of 115 (320648)
06-11-2006 9:34 PM
Reply to: Message 83 by Crue Knight
06-11-2006 1:00 AM


quote:
So, they please the world instead of standing tall for the truth?
Yeah, pretty much trying to please both sides. But it doesn't work that way. If one is right then the other is wrong.
Do you find spreading falsehoods to be "standing tall for the truth"? IF one side is right, then it doesn't need to misrepresent the other to show the truth eh?
Welcome to the fray btw. Is that some microscope picture for your avatar?
Edited by RAZD, : sp ell ing

Join the effort to unravel {AIDSHIV} with Team EvC! (click)

we are limited in our ability to understand
by our ability to understand
RebelAAmerican.Zen[Deist
... to learn ... to think ... to live ... to laugh ...
to share.

This message is a reply to:
 Message 83 by Crue Knight, posted 06-11-2006 1:00 AM Crue Knight has replied

Replies to this message:
 Message 89 by Crue Knight, posted 06-12-2006 10:05 PM RAZD has replied

  
fallacycop
Member (Idle past 5520 days)
Posts: 692
From: Fortaleza-CE Brazil
Joined: 02-18-2006


Message 87 of 115 (320678)
06-12-2006 12:42 AM
Reply to: Message 47 by Someone who cares
06-09-2006 8:54 PM


Added info
Someone who cares writes:
But the point is, no new information can be added that would be for cells, tissues, organs, systems, body parts, etc, that the organism doesn't already have.
Often times in this fora creationists make claims to the effect that no new information can be added to the genetic code. I wonder if they all come to that bogus position independently or if they read it off some missinformed source. Did you read this nonsense somewhere else and is regorgitating it at us? Or did you come up with this jewel independently?

This message is a reply to:
 Message 47 by Someone who cares, posted 06-09-2006 8:54 PM Someone who cares has not replied

  
ramoss
Member (Idle past 612 days)
Posts: 3228
Joined: 08-11-2004


Message 88 of 115 (320731)
06-12-2006 8:48 AM
Reply to: Message 84 by Crue Knight
06-11-2006 1:11 AM


Re: why Goddidit is so useless as an explanation
If you don't know how he did it, why are you ruling out that god did it throughselection with a filter of natural selection>?

This message is a reply to:
 Message 84 by Crue Knight, posted 06-11-2006 1:11 AM Crue Knight has replied

Replies to this message:
 Message 90 by Crue Knight, posted 06-12-2006 10:11 PM ramoss has not replied

  
Crue Knight
Inactive Member


Message 89 of 115 (320967)
06-12-2006 10:05 PM
Reply to: Message 86 by RAZD
06-11-2006 9:34 PM


Welcome to the fray btw. Is that some microscope picture for your avatar?
The fray?
Lol, yeah. It's a bubble in middle of being adjusted to the light on the camera.

Read "Time Has an End" by, H. Camping for great evdence that the Bible is true and the word of God. You can read it online at Time Has An End

This message is a reply to:
 Message 86 by RAZD, posted 06-11-2006 9:34 PM RAZD has replied

Replies to this message:
 Message 91 by RAZD, posted 06-12-2006 10:19 PM Crue Knight has replied

  
Crue Knight
Inactive Member


Message 90 of 115 (320969)
06-12-2006 10:11 PM
Reply to: Message 88 by ramoss
06-12-2006 8:48 AM


Re: why Goddidit is so useless as an explanation
If you don't know how he did it, why are you ruling out that god did it throughselection with a filter of natural selection>?
I dont believe in evolution. Im a creationist. I believe the universe was created in 7 days, 13,000 years ago. (Ill get to how I got 13,000 years later on my own topic)
So yeah, I dont believe in natural selection...actually against it.
I was just reffering to Theistic-Evolutionists that believes in God and evolution and tries to tie the sides together.

Read "Time Has an End" by, H. Camping for great evdence that the Bible is true and the word of God. You can read it online at Time Has An End

This message is a reply to:
 Message 88 by ramoss, posted 06-12-2006 8:48 AM ramoss has not replied

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2023 by EvC Forum, All Rights Reserved

™ Version 4.2
Innovative software from Qwixotic © 2024