The "common creator" myth

I'd like to try and tackle one of the issues that I see cropping up on this site time and again.
Whenever someone starts to talk about the evidence for common ancestry that you can see by comparing DNA sequences, the stock creationist response is something like this:"The evidence used to justify a common ancestor can just as easily be interpretted as evidence for a common creator"I've never seen this assertion properly backed up, and it often seems to me that the person perpetuating this myth doesn't know what the evidence actually is! With this is mind I'll try and explain how it works in simple terms.Here goes:First, two things have to be remembered: 1) The machinary that is involved in replicating DNA is not
perfect, it makes mistakes. 2) These mistakes are inherited.If you don't accept these two facts, you might as well go and join
the debate on a site dedicated to debating whether the earth is a
flat or not. They are facts, like it or not!So:Imagine an individual with a piece of DNA that reads:ATTGGCGTAAGTCCGTCCCCTTGAAGGAAThe red indicates a mistake (ie something not seen in the
individuals parents). This mistake is then inherited by all of its'
offspring:
ATTGGCGTAAGTCCGTCCCCTTGAAGGAA

ATTGGCGTAAGTCCGTCTCCTTGAAGGAA

ATTGGCGTAAGTCCGTCCCCTTGAAGGAA

ATTGGCGTAAGTCCGTCCCCTTGAAGGAASmiley face has another mistake (denoted by the green letter), which will be passed on to all of its' offspring. As none of the other offspring have this mistake, then any individual from now on that has both green and red mistakes then they can said to have descended from smiley face. This is the way it works for species - only scaled up: We share mistakes with chimps, we both share slightly less with gorillas....You can probably see a problem with this conclusion. An individual does not have to be related to smiley face: they could have produced the same two mistakes totally independently of the first individual. This would definitely be a problem if only one short stretch of 29 nucleotides, and two mistakes were used when putting together the cladograms that are based on DNA sequence. Fortunately, many genes and many mistakes have been analysed, so the chances of the similarities occurring by chance are fairly tiny.What we have is either:1) Evidence for descent from common ancestors2) Evidence for a creator who for some, strange, unexplained reason decided to make it look like there was a series of common ancestors!So, can anyone explain to me why they think its' just a matter of interpretation?This message has been edited by Ooook!, 07-05-2004 05:42 PM

Nice topic! I have just two suggestions:

1. Drop the current intro and replace with something much shorter. Everything from "First two things..." onward is fine. The intro's fine, too, it's just that I like the clarity you've brought to the topic, and so it would be a good idea not to introduce distracting commentary like "startling ignorance." Instead just describe the "Common Creator" myth, and that you're going to show it's wrong or doesn't fit the evidence.
   ​
2. The yellow "T" cannot be discerned as yellow. Either make the character bold, or pick a different color.

Can you post a reply with the changes?

---

--	Percy
	EvC Forum Director

Deleted on edit: Two identical posts is a bit boring.This message has been edited by Ooook!, 07-05-2004 05:45 PM

Thread moved here from the Proposed New Topics forum.

Please re make the edits in your OP directly. I don't know what happened here.

Hope that's alright.Right! Any takers?

I suspect you will have to wait until the next time someone brings up the common creator and then direct them to this topic.

Since I am fairly ignorant of genetics, I'll start off again with questions so I can understand what goes on better.First of all, how do you know what is a mistake? If a mutation is sucessfully added into the working code of an organism so that the organism appears "fully evolved" as stated in another thread, what denotes the fact that this material is a mutation or mistake? So you would have to have the DNA code of the parents AND kids to know if something is a mistake? If this is the case, I am confused as to how we know that we share the same "mistakes" as monkeys and not the same design patterns. Again, how do we know that this is not simply evidence that we share MORE similar structures with Chimps than with gorillas?

Hnagdawg13 responds to Ooook!:

quote:

---

quote:

---

The red indicates a mistake (ie something not seen in the individuals parents). This mistake is then inherited by all of its' offspring:

---

​

So you would have to have the DNA code of the parents AND kids to know if something is a mistake? If this is the case, I am confused as to how we know that we share the same "mistakes" as monkeys and not the same design patterns.

---

Because we can trace it even further back and see that it wasn't the same.Take, for example, the GLO pseudogene. Almost all mammals are capable of synthesizing their own vitamin C. Primates and hamsters are among the few that cannot. There is a multi-step process involved that converts glucose into ascorbic acid.Primates that cannot synthesize vitamin C (and I think it's all of them, but I can't recall off the top of my head so I'm being vague as to the specific species other than humans) all share the same genetic mutation that makes this process fail at the exact same place in the process.Hamsters, on the other hand, have a different genetic mutation.If a designer wanted to make an organism that couldn't synthesize vitamin C, why would he create two different broken processes? Not only that, if the intent was to prevent the organism from synthesizing vitamin C, why on earth insert a broken process? Why not just remove the process entirely?

quote:

---

quote:

---

This is the way it works for species - only scaled up: We share mistakes with chimps, we both share slightly less with gorillas..

---

​

Again, how do we know that this is not simply evidence that we share MORE similar structures with Chimps than with gorillas?

---

But that's the entire point: By sharing more with chimps, we share fewer with gorillas. Unless you are going to say that chimps and gorillas are the same, you cannot be more like one without necessarily being more unlike the other.You're begging the question: Why do we share more with chimps than we do with gorillas?

---

Rrhain
WWJD? JWRTFM!

Thank you for your reply. Cuz God wanted to make a monkey out of evolutionists? J/k... Ah! Where were you in the information/complexity debate? This shows an apparently detrimental mutation that has not been eliminated by natural selection... unless this mutation has a benefit elsewhere?Let's think about this for a second... what environmental factor would keep this mutation in the line? What benefit does this mutation provide to humans and monkeys? Does it have something to do with diet?Also, if you are able to answer, how far back does this mutation go? Where do we find the first ancestor without the mutation? Man -- monkey -- ???

Hangdawg13 responds to me:

quote:

---

quote:

---

Primates that cannot synthesize vitamin C (and I think it's all of them, but I can't recall off the top of my head so I'm being vague as to the specific species other than humans) all share the same genetic mutation that makes this process fail at the exact same place in the process.

---

​

Ah! Where were you in the information/complexity debate? This shows an apparently detrimental mutation that has not been eliminated by natural selection... unless this mutation has a benefit elsewhere?

---

Or...?Come on, you can think of a third option, can't you? In order to eliminate something, there needs to be something pushing for elimination. What do you think would happen if there was nothing pushing for its elimination?Humans and other primates get sufficient vitamin C from their diets, thus they do not need to synthesize it for themselves. So if they were to experience a mutation in their ascorbic acid synthesis genes (again, begging the question of why they would have such genes in the first place), they would never notice it.

quote:

---

Let's think about this for a second... what environmental factor would keep this mutation in the line? What benefit does this mutation provide to humans and monkeys? Does it have something to do with diet?

---

Congratulations!Now, answer the question: Why would a designer who has decided that the organism is going to acquire it's ascorbic acid via diet put in a [I][B]BROKEN[/i][/b] ascorbic acid synthesis gene?Simple: The organism wasn't designed. It evolved.

quote:

---

Also, if you are able to answer, how far back does this mutation go?

---

Quite a fair way. It's because of these mutations that we are able to create genetic family trees showing the path of evolution. We have genetic clocks that show us how quickly organisms mutate. By following lines of which organisms have the mutations and which don't, we can come up with a timeline of when the mutation happened putting bounds on when the organism split off.For example, if species A and B have a shared mutation and related species C does not have it, then the differentiation of A and B must have happened after A and B split from C. The timeline must be that C begat AB, the mutation happened in AB, and then AB split into A and B.

quote:

---

Where do we find the first ancestor without the mutation? Man -- monkey -- ???

---

Monkeys are not ancestral to humans. Humans are not ancestral to monkeys. Instead, they are cousins and share a common ancestor that was neither human nor monkey.You're trapped in the idea that current species are identical to ancestral ones. The answer to your question is not a species, per se, but higher up the taxonomic order: Mammals.Mammals are the ancestor. They overwhelmingly have the ability to synthesize vitamin C. Only a few of the splinters of the mammalian ancestor acquired the broken GLO.

---

Rrhain
WWJD? JWRTFM!

quote:

---

Ah! Where were you in the information/complexity debate? This shows an apparently detrimental mutation that has not been eliminated by natural selection... unless this mutation has a benefit elsewhere?

---

What bearing does that have on the subject? The fact that a negative mutration can survive for a long time does not invalidate the claim that mostly, negative mutations are eliminated more often than beneficial ones.

quote:

---

Let's think about this for a second... what environmental factor would keep this mutation in the line?

---

There does not need to be a postive pressure. All that would be required is that some of of coping strategy that is not too onerous develops.

Thank you for your reply.Note to all: I am not in any way attempting to bash evolution with my posts. I am simply asking questions as they come to mind, to better understand and explore ideas. You might say that a lack of vitiman C would cause the immune system to be so weakened as to weed out those individuals... but this is speculation and irrelevant. Where does the Vitiman C come from in our diet? What do these ascorbic acid genes do now that they no longer produce ascorbic acid? If you'll be patient, I'll get around to that, but first I have to understand things a little better, so if you don't mind, then just keep answering my questions and maybe we can get to the point to where we can answer this. I need to know more specifically what our first ancestor was that did not have this mutation. Apparently it was the ancestor of humans and apes. What is this ancestor? what does the fossil evidence show of him? What kind of features did he have that neither humans nor apes have? I need to know the differencences that exist between us and him as in the mutations that have accrued. What percentage of our genome is identical to other primates and what is not? So how fast do primates mutate? How many mutations per generation? What others besides humans and primates?

Thank you for your reply.Perhaps you can answer the question too: What does the ascorbic acid gene do now that it is broken as you say? And where does the vitiman C come from in our diet?I thought of another question: How many identical 'broken' genes like this one do we share with primates or other mammals? and what do THESE broken genes do now that they are broken?

I think we all understand you are not "bashing". You do ask good questions.This is from an amateur (at best) geneticist. The genes don't do anything at all. They just get copied along with everything else.It seems that the cost of carrying extra useless DNA is slow low for most animals that there is nothing to weed them out.I think this isn't true for bacteria. They can't carry so much and there is an advantage to weeding the genome down.The word "detrimental" was used in conjunction with the broken vit-C gene. In an enviroment of adequate vit C it is a neutral mutation. Detrimental, beneficial or neutral all are in relation to the environment.If humans and chimps all lived in the environment of 16th century sea farers then it would clearly be a detrimental mutation. You can't speak of mutations in that way without reference to the surroundings.The vitamin C comes from all sorts of foods.. Capt Cook gave the British the nickname "limies" because of it.