A test for claimed knowledge of how macroevolution occurs

It's evidence, not an assertion. Ignoring it doesn't make it go away. You owe me a new irony meter for the one you just broke.You just got done telling me that you can't even look at the evidence for mutations, and then have the audacity of accusing me of ignoring evidence. So says the person who can't even look at the evidence for mutations. You are projecting.

I gave you the evidence, and you refuse to even look at it. God couldn't use the same genome sequence in all species, could he? God would have had to use different genome sequences, right?

Changes from each other. We can call them differences if you like. But they are different sequences, right?Do you agree that different sequences can both be beneficial? If differences can be beneficial, then why can't differences caused by mutation also be beneficial?

No, it isn't. Your model doesn't explain the pattern of differences between the genomes of species where transitions outnumber transversions and differences at CpG sites has the greatest number of differences relative to available bases. Your model also doesn't explain why we see more differences in introns than in exons when comparing genomes from many species. Your model also doesn't explain why we see a nested hierarchy.Your model can't explain the observations we see, so it isn't coherent.

The pattern of differences are observations. If your model can't explain what we see in nature then it isn't a coherent model. It makes sense to anyone with a basic understanding of how genetics and inheritance works. For complex eukaryotes you can only inherit DNA vertically, from ancestor to descendant. Therefore, mutations that happen in a lineage stay in that lineage. This produces a pattern of shared DNA inherited from a common ancestor and lineage specific mutations. This is a nested hierarchy.

Why wouldn't the observation of ERV's in different genomes apply to your model? If your model can't incorporate the facts of biology, then it isn't a coherent model.

If observable facts are meaningless in your model then it isn't a coherent model. Can you explain why the genetic differences between species is irrelevant in your model? Don't the genetic differences between species explain the physical differences between species within your model?

Why don't DNA sequences have any relevance in your model?Are you saying that your model can't explain anything about genetics?

Why would the differences between genomes be irrelevant for two species that are not related? In your model, what causes a chimp to give birth to a chimp and not a human? Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?

That's not what I asked. Please answer the question.In your model, what causes a chimp to give birth to a chimp and not a human? Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?

Let's look at a vital human gene, cytochrome c.Below are the two coding sequences for cytochrome c in humans and chimps.

Human                    ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACC
Chimp                    ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCATACC
                         ******************************************************** ***

Human                    GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAG
Chimp                    GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTCGGGCGGAAG
                         ************************************************** *********

Human                    ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
Chimp                    ACAGGTCAGGCCCCTGGATATTCTTACACGGCCGCCAATAAGAACAAAGGCATCATCTGG
                         ******************** ******** ******************************

Human                    GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
Chimp                    GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
                         ************************************************************

Human                    ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
Chimp                    ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
                         ************************************************************

Human                    AAAGCTACTAATGAG
Chimp                    AAAGCTACTAATGAG
                         ***************

So how does the creationist model explain how out of 315 bases there are just 4 that are different between human and chimp? Why should we see two separately created species with such similar DNA?

Then the creation model can't model biology because genetic differences are a biological fact. If you can't explain what we see in genetics, then your model doesn't work.More to the point, the evolutionary model can explain all of this.

Did God start with a common design and make changes to it?

Then why is 98% of the chimp genome identical to the human genome?

Then what does the creation model predict for the patterns in those diffeences, or does it make any prediction at all? For example:1. What should the pattern of differences be for transitions, transversions, and CpG's?2. What should the pattern of differences be for a comparison of introns and exons?3. What should the pattern of differences be between different groups of species?Can the creation model make any predictions with respect to those differences? Then it should be able to answer those 3 questions above.