The Common Ancestor?

The DNA evidence for a common ancestor is overwhelming (e.g. ERV's). Whether or not we have found a fossil specimen that is our ancestor (which we couldn't determine anyway since it would require a DNA sample) does not refute the DNA evidence.To use an analogy, imagine a murder trial where the defendant's bloody fingerprints, DNA, and fibers were found at the scene of the crime. Would not finding the defendant's shoe prints refute any of this evidence?

Like others have stated, it depends on the comparison that you are making, but 96% across the entire Hominidae family is a good approximate number. Yes, there are lineage specific insertions for every ape species, including humans. These are retroviral insertions that occurred since each lineage branched off from the common ancestor. However, we still share the ERV's that were part of the common ancestor's genome. Again, depends on the comparison. If we ignore insertions and deletions of DNA I think the number is closer to 99% at the DNA base level. No, just like there isn't any dog variety that is between chihuahuas and great danes. Modern humans and neanderthals were cousins.

No. The more distant the common ancestor between any two species ther more time there has been for the accumulation of point mutations. There are 3 ways that DNA can be modified (i.e. mutated). They are as follows:

Original DNA:
TTTAAAGGGCCC

Point mutation (a T is changed to a G):
TGTAAAGGGCCC

Insertion (the three C's at the beginning are inserted):
TTTCCCAAAGGGCCC

Deletion (the G's are deleted):
TTTAAACCC

Edited by Taq, : No reason given.

Just about every concept in biology is plagued by the same problem. As I often like to say, biology is messy.But as you say in a subsequent post, if we jump through time in bigger jumps it is obvious. At one point there is an interbreeding population. When we come back at a much later time there are now two populations that do not interbreed with all members in both populations being able to trace their lineages back to members of that past population.To use another analogy, there is no obvious demarcation between tall and short but all of us can agree that Danny DeVito is short and Shaquille O'Neal is tall. Taxonomy, the definition of species, and the very process of speciation are plagued by the same problems. With very fine resolution it is really hard to tease out the differences, but with the long lens of time we can see the obvious trends.

But we can still state that ALL members of generation B have ancestors in an earlier generation A, can we not?Let's look at humans and chimps. When we say that humans and chimps share a common ancestor, or more accurately a common ancestral pool, we are saying that at one point in history there existed a single generation of interbreeding individuals. All humans and all chimps can trace their lineages back to members of that single generation. I think "hypothetical" is a much better term than fantasized or non-existent.

You can use a third species such as the gorilla. Even without a third species you can tell that DNA has either been deleted in one lineage or added in another because of the homology on either side of the indel. For example, below is a mock comparison of random sequence. Indels are marked by dashes:

Human
AAATTGTTGCCG---ATGCCCCAGTTGT
AAATTGTTGCCGTTCATGCCCCAGTTGT
Chimp

Whether the TTC was deleted in the human lineage or inserted in the chimp lineage can not be determined by this comparison alone which is why it is called an indel (insertion and deletion combined). However, if we add the gorilla sequence we can learn more:

Human
AAATTGTTGCCG---ATGCCCCAGTTGT
AAATTGTTGCCGTTCATGCCCCAGTTGT
Chimp
Gorilla
AAATTGTTGCCG---ATGCCCCAGTTGT

From this comparison we can determine that the TTC was inserted in the chimp lineage.

The important concept here is gene flow. Whether or not two species can produce fertile offspring is not important. What is important is do they produce fertile offspring when given the chance. What we want to know is if mutations can flow freely from one population to the other. If not, then the populations are diverging.Of course, this definition only applies to living species who reproduce sexually. This doesn't apply to things such as fossil species or bacteria.

I disagree. The term "common ancestry" should be used correctly. Also, common ancestry is not based on speculation. It is based on evidence.

Conceptually, we are looking for the most recent ancestor. In the case of humans and chimps, we are looking for the most recent interbreeding population that contained all of the ancestors of both living humans and living chimps.This is not to be confused with common ancestry of a single gene. I think this is where the confusion is occuring. It is very probable that the common ancestor of a shared chimp/human gene is much older than the members of the most recent common ancestral population. Without DNA from 5-7 million year old hominid fossils it is impossible to determine. Then we are only looking at the species that contains the most synapomorphies which still does not guarantee direct ancestry to any living organism, human or chimp. DNA is the only way to establish direct ancestry.

How could I have bred with any other species millions of years ago? I know I am getting older, but you are really making me self-conscious. Do I really look that old to you?

It means having an ancestor in common like you and your cousins have your grandparents as a common ancestor. Different data sets. Mitochondria and the nuclear genome accumulate mutations at different rates so knowing both estimates gives us a better overall estimate. They each have their own sets of DNA polymerases and DNA error correction systems (if memory serves). This results in different rates and patterns of accumulated mutations.

French, Italian, and Spanish are all descendants of the Latin language. Does this mean that at one time the Italians spoke French, or that the ancient Romans spoke Spanish? No. These languages share a common ancestor: Latin. Each language branch accumulated different changes over time resulting in three populations that can no longer understand each other's native tongue.It is the same for us and mice. Our common ancestor was neither a mouse nor a human. When our lineages split each lineage started accumulating different changes resulting in each lineage looking less and less like the other. The END RESULT of this process is mice and humans just as the end result of the evolution of the Romance languages is French, Italian, and Spanish (amongst others).

The same information that everything in the universe has. Humans look at stuff and extract information from them in order to determine their state and their origin. This is true of rocks, clouds, and life. Same type of information in all of them. We are able to determine the DNA sequence which tells us how long it has been since two species shared a common ancestor. The more distant that common ancestor the more the DNA sequences for a shared gene will differ. It would be harder if they DIDN'T share any parts.

If you fed rats methanol and exposed them to light they would go blind. Does this mean that methanol carries the information for blindness?

DNA is not an abstraction. If we replaced the DNA molecule with a very tiny piece of ticker tape with letters typed on it we would no longer have a viable cell. However, with abstract human language we can change the physical state of the letters in any medium and still convey the same abstract information.For DNA it is the chemistry that matters. This is not so with abstract information created by intelligent species like our species.