Problems with evolution? Submit your questions.

And because it has no selective pressure it is not analogous to the Theory of Evolution.This has been pointed out to you already.

Code is code my friend. Can you name one code that has no code maker?

Or to put it another way, your original point about frogs and AERs was total bullshit, so now you are trying to change the subject and act defiant, instead of admitting that you were 100% wrong.Fine.The ToE does not predict that every single feature must entirely homologous to features in every other member of a group. That would just be ridiculous. Evolution predicts that some species will have novel features and that is exactly what we observe in the case of this tree frog.Only a creationist could point to a case of a species displaying a novel morphological feature and call it evidence against evolution. Whatever de Beer said, it is clear that he did not consider it evidence against evolution, nor does he argue here against the concept of homology, so your point remains obscure.Also; de Beer died nearly forty years ago. Nice up to date source on your genetics info there champ! You might like to try something a bit more recent. Genetics has moved on quite a bit since then you know. But I guess that just cutting and pasting from creo websites, as you did here, is a little less taxing on your little grey cells. You have not demonstrated that any such thing happened though. All you did was repeat Jonathon Sarfati's mendacious and moronic drivel about frogs.Did I mention that you were wrong about that and that Sarfati is an idiot?Mutate and Survive

---

On two occasions I have been asked, — "Pray, Mr. Babbage, if you put into the machine wrong figures, will the right answers come out?" ... I am not able rightly to apprehend the kind of confusion of ideas that could provoke such a question. - Charles Babbage

You only quoted a small portion of what Perdition said, plus you seem to have forgotten the context. One of your questions was how we would tell the difference between English and gibberish, and the paragraph containing the sentence you misleadingly excerpted explains that in DNA there is no gibberish. Every single 3-nucleotide sequence code (known as a codon) codes for an amino acid . There are no meaningless codons in DNA, no equivalent to gibberish.Of course there are possible indicators of significance at the gene level. For instance, we recognize non-coding regions by the lack of start and stop codons. How does your specified complexity calculation take start and stop codons into account?--Percy

DNA.There's also the Honey Bee Waggle Dance:https://www.youtube.com/watch?v=-7ijI-g4jHgSorry that embedding was disabled.

quote:

---

Waggle dance is a term used in beekeeping and ethology for a particular figure-eight dance of the honey bee. By performing this dance, successful foragers can share with their hive mates information about the direction and distance to patches of flowers yielding nectar and pollen, to water sources, or to new housing locations.

---

Waggle dance - Wikipedia

I don't see how "So far as it causes no one else harm, allow people to behave how they want" will be affected by this at all. Since that's my "worldview" you seem to be barking up the wrong tree.As for mutations being random, you're conflating two entirely different things.AAG is a codon, a series of three nucleotides. This codon is a legitimate "word" in genetics as a certain amino acid is produced when RNA gets to this codon. In this case, it means lysine.Now let's add a random mutation, It can be anything, say the G turns to another A, or to a C, or one of the As changes to a G or C, or a frameshift takes place, where the A's are shifted down one and the G before it turns the codon to GAA. These are all random pssibilities. Yet all of these codons code for something.In fact, if the G were turned into an A, it would actually code for the exact same amino acid: Lysine. What I'm saying is that any random series of nucleotides will code for a protein (assuming the RNA is told to being reading). And changing any of those random nucleotides to another nucleotide will still code for a protein.Now, that protein may or may not do what the previous one did, but that's where selection would come into play to determine if the this new protein was good, bad or indifferent as far as the animal's chances at life and procreation.The mutations are random, but no matter what the mnutation is, it will still be a valid "sentence." There is no combination of nucleotides you can come up with that won't be valid. Nope. That's not a fact of life. Every code that humans have made have been made by humans. That's tautological. Any codes not made by humans were not made by humans. That's also tautological. Show me a code not made by humans, and then show me the creator who made it.And you still need to show exactly what specified complexity is and how you measure it. Until you do, you're saying gibberish.I say codes are codes because of glorfang. I dare you to show me a code that doesn't have glorfang. If you can't, then you've just proven my argument.

Actually, some people thought they weren't.Now, here's a puzzle for you. This is the Phaistos disc. Some people think that it is a unique example of writing in an otherwise unknown script, and so presumably has meaning. Others think that it's a set of meaningless symbols that look like writing produced as an ingenious hoax on archaelogists. Perhaps some clever creationist could tell us which.Once you're done with that, you could start in on the Voynich manuscript. It's undoubtedly medieval, but is that a real language, possibly written in cipher, or was it just a hoax to appeal to a buyer of rare and exotic books, produced by writing the letters of the script at random? And possibly your post also has meaning, but it is difficult to detect.

Well, there's the so-called "genetic code".Can you name one code that has a supernatural code-maker?But what would your assumption that the code has a designer tell us about its content? How, for example, do we then distinguish between a string in that code that was the product of an intelligent being and a string in that code that is the product of evolution?Edited by Dr Adequate, : No reason given.

Are you saying that the sentences randomly produced by my unintelligent computer would possess specified complexity?

Then please use one of these methods to measure the information/SC content of this DNA sequence:

quote:

---

GCGTATCCTATATATTAAGTTAATTCTTATGGAATATAATAACATGTGGATG
GCCAGTGGTCGGTTGTTACACGCCTACCGCGATGCTGAATGACCCGGAC
TAGAGTGGCGAAATTTATGGCGTGTGACCCGTTATGCTCCATTTCGGTCAG
TGGGTCATTGCTAGTAGTCGATTGCATT GCCATTCTCCGAGTGATTTA

---

We have yet to see you measure information/SC.

I can name many for which there is no known code maker, DNA and electron orbitals being two.If you want to claim that a code requires an intelligence then it is up to you to demonstrate it.

No one is claiming that they do. We are talking about biology and evolution. Will you be joining this conversation?

Dembski is possibly more of an idiot than Sarfati. No Free Lunch has been absolutely and completely shredded by the scientific community, and yet these arguments still come up.Here are some examples from our friend Wikipedia why you cannot place any weight on Dembski's notion of specified complexity: I cite these examples solely because you seem to be placing great reliance on the idea of "specified complexity" to insist that DNA is evidence of a designer, without fully appreciating how this concept put forward by Dembski holds no merit.And the comment "An earthquake at the Scrabble store will never write a novel" is nothing more than a rehash of Hoyle's fallacy.

This analogy is not, in fact, analogous to evolution. If you could understand this minor thing, it would be a huge step-forward in your ability to knowledgeabley debate this topic.First of all, for an analogy to be vaild, it has to have the same basic number of factors as the thing it is supposed to be an analog of. Evolution has three, and your analogy only has two.Evolution's three basic factors are:
Starting materials. In evolution, DNA, in your analogy, Scrabble pieces.A randomizer. In evolution, mutations, in your analogy, an earthquake.A weeder out of the bad and a keeper of the good. In evolution, natural selection, in your analogy, ????So, your analogy doesn't work for evolution, so saying that something like it is impossible says nothing whatsoever about evolution.We could add in the fact that evolution has thousands or millions or billions of iterations, whereas yours has at most a handful, depending on aftershocks and such, but it's not necessary to beat a dead horse. ;-)Edited by Perdition, : Spelling

Hi Dr Adequate. Not true, otherwise scale model testing of large ships would not work. The reason scale models are used in tow test tanks is because the effects can be corrected by using the Reynolds Numbers to adjust the effects.Reynolds number - Wikipedia

quote:

---

In fluid mechanics, the Reynolds number Re is a dimensionless number that gives a measure of the ratio of inertial forces ρv2/L to viscous forces μv/L2 and consequently quantifies the relative importance of these two types of forces for given flow conditions. The concept was introduced by George Gabriel Stokes in 1851,[1] but the Reynolds number is named after Osborne Reynolds (1842—1912), who popularized its use in 1883.[2][3]

​

Reynolds numbers frequently arise when performing dimensional analysis of fluid dynamics problems, and as such can be used to determine dynamic similitude between different experimental cases. They are also used to characterize different flow regimes, such as laminar or turbulent flow: laminar flow occurs at low Reynolds numbers, where viscous forces are dominant, and is characterized by smooth, constant fluid motion, while turbulent flow occurs at high Reynolds numbers and is dominated by inertial forces, which tend to produce chaotic eddies, vortices and other flow instabilities.

---

Not that I want to do the calcualtions, but it could be done.A 1" scale yellow pine tank-test model for the twelve-meter class America's Cup challenger Sceptre, circa 1958

quote:

---

A 1" scale yellow pine tank-test model for the twelve-meter class America's Cup challenger Sceptre, circa 1958

---

And, imho, no matter how small you do the testing, a propeller will still outperform a long spinning string that has a lot of extra surface drag in addition to little propelling surface.This is because a propeller uses the lift effect as well as the push effect, say of a paddle, in contrast to the vortex drag that would form around a spinning string or hose that goes off in chaotic directions where most of the energy is wasted rather than used for propulsion.This is why fish have paddles instead of string fins ... and eels use a flattened body that "snakes" back and forth in a plane perpendicular to the flattened body, rather than spin.What you have, is once again a trait that is adapted from previous function/s to a new use, not because the end result is the best possible design, but because it is just adequate enough to do the job.Enjoy.

---

we are limited in our ability to understand
by our ability to understand
Rebel American Zen Deist
... to learn ... to think ... to live ... to laugh ...
to share.

---

Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click)