What exactly is ID?

quote:

---

Smooth Operator told us that natural selection selects for fitness. I don't entirely agree. The "reality" is, it selects for anything that gives an organism an advantage whether it is fitness, size, color, shape and mutations, etc.

---

Natural selection is defined as selecting for population's fitness. And so I use it as such. But in reality it it's not doing a very good job. If it did, we would not have the problem of genetic entropy that we do have. Obviously natural selection only selects for fitness when the mutations are extremely deleterious. Slightly deleterious mutations do get passed on.

quote:

---

Then, of course, there are the beneficial mutations.

​

Don't forget, they get passed on too.

---

Beneficial mutations like the ones that cause sickle cell anemia actually deteriorate the information in the genome by deforming the red blood cells and making them less, not more, efficient.Regardless of that, natural selection is still ineffective at preserving the living organisms simply because even if by cahnce, a really good beneficial mutation happens, which does not deteriorate the information in the genome, the amount of deleterious mutations in the same individual is higher. Therefore, both beneficial and deleterious mutations get passed on. But since there are so much more of deleterious mutations, not only do they outweigh beneficial ones, they inevitably lead to genetic entropy.Becasue you always have to remember that all individuals have mutations. The selection does not happen between mutated and non-mutated individuals. But between less mutated and more mutated. And as time goes by, mutations accumulate, and lead to the genetic meltdown.

quote:

---

This basically means nothing. You can't quantify the net change in information involved. All you can do is make a subjective judgement and then label it a loss of information.

---

That's like saying that a sequence that codes for an eye is replaced with a sequence that codes for nothing, is not a net change. Obviously it is.

quote:

---

Does the change in haemoglobin make it a less efficient oxygen binder, no. Does it change the efficiency of the blood to transport oxygen, yes. Does it increase the carrier's resistance to malaria, yes. These tell us some of the things that the mutation to the sickle cell from of haemoglobin (HBsc) leads to but it doesn't give us a way to quantitate the informational change involved.

---

Of course it does affect it's oxygen binding ability, that is one of the points.The way to quantify the net change is to se which functions were diminished and which were increased in effectiveness. Both binding and transportation of oxygen are diminished. Therefore, this is a loss of information. The to quantify the loss we simply need to know how many nucleotides have changed.The resistance itself is not a biological function. It is an inability of malaria to infect the body.

quote:

---

It would be more accurate to say that the selection is between differently mutated individuals, rates of mutation in populations are relatively consistent. It is the nature of the specific mutations that are important, not simply the number of them.

---

That is also true, but you missed the point. The point is that ALL individuals are mutants. And as such they have both beneficial and deleterious mutations. Regardles of the ratio, the deleterious ones stick and spread across the population. Causing the geentic entropy. Teh point I was trying to make that no matter how teh selection works, or how intense it is, you still do select for deleterious mutations.

quote:

---

Maybe, hypothetically, or not as the case may be.

---

No, I'm sorry this is a fact.Just a moment...This link here explains how 110 mamalian species were tested and a clear case of accumulation of slightly deleterious mutations was noticed.

quote:

---

As we have discussed before there are plenty of models which do not lead us to expect genetic meltdown to be an inevitability, including models with synergystic epistatic interactions between mutations and those incorporating nearly neutral balancing mutations.

---

Yes but those models are not reality. As I have shown above, reality is a bit different than those models. Those models are nothig more than mathematical artifacts. Natural seelction does not work that way. Even if it did interactions between two deleterious mutations would still be deleterious. Even with slowed down rate of entropy, it's still happening. And as you can see from this here graph, it doesn't stop the accumulation.File:Synergistic versus antagonistic epistasis.svg - WikipediaYes, it slows it down by a lot, but it does not stop it.

quote:

---

Is genomic 'information' for you simply a function of organismal fitness? Something divorced from the actual specifics of the underlying genetic change. Is it tied to the specific biochemical functionality of the individual proteins? If so who determines what functional changes represent increases or decreases in information? We've touched on these questions before but you have never answered them satisfactorily.

---

Genetic informations are the biological function that is encoded in the genome. For an example, if you have a sequence that codes for an ATP synthase, and you mutate it so that after a while the same sequence produces a machine that does not produce energy anymore, and simply stands there, it lost information. If it so happened that in acquired new information for producing something else, than that would be a gain in information.

quote:

---

And how much time has gone by?

​

6,000 years?

​

There's the problem, you see. This genetic meltdown is the pride and joy of those who believe in "the fall" and a young earth. It is not something established by science.

​

And it is no wonder that it is also a part of "intelligent design" as ID is a direct outgrowth of religion, not of science.

​

When you admit that we live on an old earth, with evolution acting over billions of years, and when you realize that "the fall" is a religious concept with no applicability to the real world, the entire basis of genetic meltdown simply disappears.

---

I gave you a chance to have decent conversation. You declined by instantly throwing out religious arguments. Therefore I bid you goodbye.

quote:

---

Yes, it is like saying that because anyone who talks about 'a sequence that codes for an eye' is essentially saying 'I don't understand developmental biology' in the same way your statement shows that you don't have a coherent understanding of genetic information.

---

Am I supposed to copy/paste individual sequences to you so you would understand what I'm talking about?TACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCC
TACCTGGTGGGGGTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCCThe first sequence is a rat's active GULO gene sequence. The lower one is a human one. The human one is different and is unable to synthesize Vitamin C. Threfore, the information was reduced, becasue the function of synthesizin vitamin C is lost.

quote:

---

It affects it when the HBs forms polymers, but the actual individual haemoglobin molecules retain their normal binding affinity (Bonaventure et al., 1999.

---

Loss in polymer affinity is enough to say it's a loss.

quote:

---

This is what I'm talking about, you make a totally subjective judgement call that undercuts the validity of your whole approach. You are totally divorcing the concept of biological information from what we identify inc complex evolved systems, it isn't a question simply of having some form of molecular function, it is about wider biological function in terms onf environmental interactions, which resistance to amlaria would certainly qualify as.

---

Well than you simply have a wrong definition of a biological function. If you are going to equate the workings of a flagellum with an inability of malaria to infect the body, be my guest, but that approach is invalid.It's like equating the working of a HDD with a broken HDD and claiming that borken HDD has gained a new function. And the new function is the resistance of viruses it could have caught over the internet.

quote:

---

As to looking at nucleotide changes to quantify the loss, this is no answer at all, you could have just as many changes with no effect on function whatsoever.

---

Which just means there was no loss. Where seems to be the problem? If you change the sequence and you find there was no loss of function, than that means that the amount of information remains the same.

quote:

---

I'm quite happy to accept that the mitochondrial genomes of larger mammals with small effective population sizes may be subject to genetic meltdown. What I dispute, and this paper does nothing to support, is the contention that this is a universal trend in all genomes, or even all vertebrate genomes. The paper certainly doesn't demonstrate the inevitability of genetic entropy leading to extinction.

---

Of course it doesn't, becasue it's not supposed to. I need you to extrapolate on that a bit. If you throw a rock in a lake, it's going to make waves. If you throw it in an ocean, it's probably going to make waves also.No matter the population, the effect is the same, you just need to extrapolate it. No genome is special, they are all based on the same basic principle. If one species is shown to deteriorate, than there is no reason to think millions of other species are not going to. My question to you is, why do you think other genomes are so special that they would not deteriorate over time?

quote:

---

I see that you still don't understand that graph, it doesn't say anything about changing the accumulation of mutations, it talks about the difference epistatic effects have on the fitness effects of cumulative mutations. The point is that the steep drop off in the negative synergistic epistasis line means that the accumulation of only a few mutations will produce a non-linear change in fitness and consequently a non-linear change in selective pressure against the carrier.

---

Which means that less mutations will accumulate in the population. Still, the obvious drop in fitness is obvious. I know what the graph shows. It shows that with the larger numbers of mutations, the synergistic epistasis model is more efficient.Now again, I need you to extrapolate. If we clearly know that all individuals are mutants with deleterious mutations, and we include synergistic epistasis as the model of natural selection that is in operation, it will simply mean that mutations accumulate. Yes, at a very much slower pace, but they still accumulate.

quote:

---

This is the sort of vague definition I am talking about. This doesn't tell us how to measure information at all. All it does is let us identify the extreme case where the gene completely loses its function. Have you settled on the Hazen/Szostak form of 'functional information', if so you should bear in mind the limitations they themselves identify with their approach.

---

I am not using their definition, and as I already told you, I never was. I simply argued that it existed, that is all.My preference was always Dembski's CSI. Which is obviously quantifiable. If we have a, let's say a flagellum that is coded for with 800 bit sequence. Now I know there is a lot more bits needed to code for a flagellum, which is actually 4,639,221 base pair long, but I'm making it easier to understand.So, we have this 800 bit sequence, we also denote it as a: "bidirectional rotary motor-driven propeller". Becasue that is the patternt it maches, which makes it specified, and also since it is more than 400 bits long, it constitutes complex specified information - CSI.Now we notice mutations that makes a part less functional, or even removes it, such as if the pattern that still works, is now described as: "bidirectional rotor", which would imply that it lost it's tail.We would than simply count the remaining base pairs, which describe this remaining pattern, and conclude that, let's say 750 bits of information code for the remaining parts. This means that 50 bits of information are lost.Edited by Smooth Operator, : No reason given.

quote:

---

Hi Smooth Operator,

​

For a change, you will get no fighting or debate from me in this post. I was thinking Dembski's CSI was partly arbitrary although, I do not know how he came up with the number of 400.

---

Hi traderdrew! What do you mean by arbitrary?The number 400 isn't arbitrary though. It's the -log2 of 10^120. That is the number of bit operations teh observable universe could have performed in about 15 billion years on all the elementary particles it has, which is 10^90. Since to fully search a sequence space of 400 bits is 10^120 bit operation, or trials, that means that random chance in the whole universe could have only produced 400 bits of information.

quote:

---

Take the example of a postage stamp. The serrated edges might imply design but it is a form of redundancy.

---

Do you mean becasue of it's repetitiveness? Yes, that is true, it's redundant. Something like that is explained by Kolmogorov complexity. You use the shortest possible pattern to describe the object.For an example, the sequence "111111111111" can be described as: "Repeat "1" 12 times.Also something like this: "010101010101" can be described as: "Repeat "01" 6 times".Unlike "01110010100" which isn't compressible like the two sequences above, and it's shortest description is it'self: "Copy 01110010100".Therefore, the edges have a very easy to describe pattern. Let's say there are 40 ridges on a post stamp. The easiest way to describe that pattern is: "Repeat ridge 40 times." Therefore, it's a very simple pattern.

quote:

---

The image on the stamp refers to an actual object and this part of the stamp is not redundant. What is the word I am looking for?

​

Something that is complimentary is a part of a whole such as a part of an engine or a flagellum.

​

Coherence is another word I have been tossing around in my mind but it doesn't describe the relationship of an image of a postage stamp to the actual 3D subject or object the image portrays.

---

Well it seems you are looking for what Dembski described as "specification". An independently given pattern that describes the object we are looking at. For the flagellum, that description would be: "bidirectional rotary motor-driven propeller"

quote:

---

Any thoughts of a new definition of information arising by intelligence?

---

You can always look at the work of Werner Gitt. His approach is a more general one. His definition consists of more levels than Dembski's but it's not quantifiable. Dembski's CSI is defined by Mereology and Statistics. While Gitt's is defined by: Statistics, Syntax, Semantics, Pragmatics and Apobetics.Edited by Smooth Operator, : No reason given.

quote:

---

While Dembski;s CSI MAY be quantifiable in simple cases, that isn't the way to do it. You've made two big assumptions (that the actual sequence is the only way to get the function and that the sequence is assembled entirely randomly). Neither is likely to be true in a real case. You need to calculate the probability of the specification being met in the absence of design - and you haven't done that.

---

1.) We are trying to get the probability of this sequence, not some other. There may very well be other ones that work well, but we are working with this one right now. What you actually have to show is that there is a possibility of a considerably large amount of sequences than can code for a flagellum.If you read Dembski's NFL, in his calcualtion he defined the E. Coli as consisting of flagellum as consisting of 4289 proteins, which is 4,639,221 base pairs. Out of which 50 proteins are used for the flagellum. And gave the possibility of 10 interchangeable parts. For which there is no evidnece than the flagellum can be modified by that much.2.) The sequence is calcualted that way because the NFL tehorem itself says that averaged over all sequence sapces, no algorith outperforms any other. And is thus no better than random chance if it does not take into account any prior problem-specific information. Since evolution is an algorithm, that means that if there is no prior input from an intelligence, it's as good as random chance.

quote:

---

Also, you've hit the big flaw in Dembski's CSI in that a specification based on the observed pattern is NOT the same as a specification produced without that knowledge. Dembski has recognised the problem by won't to the best of my knowledge has not yet found a way of dealing with it (and probably won't bother because the practical problems of using CSI in biology were already insurmountable rendering the whole thing utterly useless to ID).

---

You have to have some knowledge in order to descibe the observed pattern. It's called a descriptive language, aand can be any language. Mostly English because it's the easiest to use.

quote:

---

If you are just trying to get the probability of a specific sequence then you are NOT using Dembski's CSI. If you are trying to use Dembski's CSI then YOU have the burden of dealing with all the sequences that meet the specification. I don't have to show anything other than that you have failed to correctly follow Dembski's method.

---

And that's why I said that out of 50 protein parts, 10 parts are assumed to be interchangeable.

quote:

---

I've done better than that - I've read The Design Inference. And to measure the variations possible even within the limits of the E Coli flagellum (which itself is taking too narrow a view) you need to consider what variations witin the protein sequences are possible without disrupting function.

---

How is that better, since basicly NFL came out after the Design Inference?Anyway, as I said above, Dembski assumed 10 interchangeable parts. If we are going to be more specific we can look at Doug Axe's work.

quote:

---

Using locally-randomized sequence libraries of a portion of the antibiotic resistance enzyme Beta lactamase, Axe calculated that somewhere between 1 in 10exp50 and 1 in 10exp77 150 amino acid-long protein folds form configurations with a Beta lactamase function (7). Of these one in 10exp50 to 1 in 10exp74 form folded structures that might perform any number of alternative functions (7).

---

http://www.arn.org/...nimal_complexity_relegates_life_originYou see, by modifying the already existing protein with mutations, untill it loses all function we can know which sequences would corespond to the original working specification. The number is somewhere between 10^50 and 10^70. So we take this number of 10^20 working combinations and this increases the chance of protein evolving. So if a certain molecular machine had a 1:10^200 chance in evolving. We can now calculate it at 10^180. These are all relevant sequences that fit the specified pattern.

quote:

---

That would be averaged over all fitness spaces. Unfortunately that doesn't tell you how well evolution will do at finding a working (NOT necessarily optimum) solution given the actual situation. The NFL theorems aren't much use to you.

---

It tells me that if evolution does not use any prior knowledge it's probably as good as random chance. Do you have any evidence that the laws of nature are set up in such a way that evolution does perform better than random chance in inputing novel information into the genome? Or do you accept the evidence from genetic entropy that clearly shows it's not working so well?

quote:

---

Using an observed pattern IS the problem. The probability of getting 500 heads in 500 tosses of a coin is 2^-500. The probability thatt 500 tosses of a coin can be completely specified is far higher. (500 tails is specified, alternating heads and tails is specified - in fact you can probably specify any sequence if you work hard enough).

​

Thus specification derived from observation is not good enough.

---

But it's not an independently given pattern, therefore, it's not a specification. It has to describe something else.For an example. Any hill side is complex and has a pattern. But only one hill side has 4 US presidents on it. And therefore it has a specifiaction. You see, that hill side, Mount Rushmore, has an independently given pattern to it. And that's why it's differnet from other naturally occuring hill sides. And that's why we know it's designed.Edited by Smooth Operator, : No reason given.

quote:

---

Thanks for your response! I have been wishing to communicate with proponents of ID.

---

No problem, glad to be of help.

quote:

---

Yes and adding to the description, the images on Mount Rushmore have a "specified" relationship to the people it depicts. We recognise the images as a designed sculpture with a high amount of details that refers to something else that is real.

​

It now sounds to me that Dr. Dembski has checkmated the materialistic evolutionists. It is certainly worthy of more investigation.

---

Well not yet actually, but very soon. The next peer reviewed paper by Dembski is supposed to be published soon. It talks about vertical NFL theorems. And as Dembski said it, with the horizontal NFL theorem in place, this one is going to be the final nail in the Darwinian coffin. Watch out for my short explanation in the next few posts...

quote:

---

Probably ALL of them could be changed for similar proteins. At least one could bne left out altogether without loss of function.

---

Could be, but we don't know that for sure.

quote:

---

Because The Design Inference is (supposedly) an academic level book aimed at describing Dembski's method. NFL is a popular level book where Dembski botches his own method.

---

No, he actually improves on it and deals with the NFL theorem to boot. The paper he wrote in 2005 went even further. Basicly the CSI defined in The Design Inference is the oldest possible model you could use.

quote:

---

Which demonstrates that quite serious mutation is needed to remove function from a protein. Therefore indicating that if you were allowing for sequence variations all of the proteins could be replaced.

---

By how much different proteins? The chance of the flagellum forming by chance according to Dembski in NFL is 1:10^2954. If we add the possibility of modification and the flagellum still working fine, according do Axe's work I showed you, we would be justified to cut off 10^20 from this number. And would still be way over 10^120. Which is the limit of computation of the whole universe.

quote:

---

Then you've been fooled by Dembski. The NFL theorems don't tell you any such thing.

---

Oh, well than please tell me, why is any algorithm better than random chance averaged over all fitness functions?

quote:

---

Yes. The change of fitness related to changes ing traits is not purely random. You will rarely find a small variation in a trait having a huge effect in fitness nor another small step in the same direction having a huge effect in the opposite direction. Thus the fitness landscape will not be the random mess which the NFL theorems focus on. Any reasonably well-behaved landscape will be more conducive to search algorithms than a random one. And that is just one problem with applying the NFL theorems.

---

That is not what I asked for. I asked you to show me why do you think evolution is going to input CSI into living organisms. The way you are going to do that is to show me novel biological functions that evolved in nature or in a lab.

quote:

---

No, I don't accept that speculation (which is not evidence).

---

No, it's not a speculation, it's a FACT. And I already presented this link few posts ago. Did you miss it? It talks about the evidence of the accumulation of slightly deleterious mutations in 110 mammalian species. It would seem that evolution is not cut out to do the job you thought it was.Just a moment...

quote:

---

If you don't accept a specification derived from observation as valid at all you are completely rejecting Dembski's method.

---

That is not a specification, that's a fabrication. You obviously didn't read Teh Design Inference very well, or you read it a long time ago. Please note the difference between a specification and a fabrication.

quote:

---

Specified information is always patterned information, but patterned information is not always specified information. For specified information not just any pattern will do. We therefore distinguish between the "good" patterns and the "bad" patterns. The "good" patterns will henceforth be called specifications. Specifications are the independently given patterns that are not simply read off information. By contrast, the "bad" patterns will be called fabrications. Fabrications are the post hoc patterns that are simply read off already existing information.

---

http://www.arn.org/docs/dembski/wd_idtheory.htm

quote:

---

Unfortunately we know it is deisgned because of our background knowledge of human beings and human activities. That's why we don't need to do Dembski's probability calculations. The same, alas for ID, cannot be said for anything in biology.

---

But if we didn't know it was designed, we would still infer design. With or without Dembski's method. Simply because our intuition would tell us it's designed.A clear evidence for what I have just said is the Rosetta Stone. Nobody ever saw it get designed. But it is a clear case of design. And when it was found, design was infered.

quote:

---

It's more certain than anything you've offered. Unless you want to argue that Axe's work is inapplicable in this case.

---

What's certain is that you can't on average change the protein beyond 20%. Anything else is a complete loss of function.

quote:

---

That's odd because he hasn't owned up to any real improvements. The NFL theorems aren't even relevant to the method.

---

Of course they are relevant. They show that you can't get new CSI by the use of algorithms. Algorithms are only used to transmit CSI.

quote:

---

You mean you want me to provide data that Dembski should have used in his calculations ? Isn't it in his book ?

---

Nope, I told you, it's about 20%. You can even look at the critique on Panda's Thumb of Axes work. They don't agree that this work support's ID, but what do they know anyway. The point is, that the number of 20% is the limit of change.Axe (2004) and the evolution of enzyme function

quote:

---

Which is based on his idea of an individual of an individual flagellum forming by chance. The idea that bacteria GROW flagella seems to have escaped him. It would have been muuch better had he calculated the probability that a bacterium would evolve a means to grow some sort of motility aid...

---

You missed the point of the entire book. First of all, it doesn't matter that bacteria grow flagellums. The information they have to grow one still has to be acounted for. Teh reason Dembski got that number is that because without prior knowledge any algorithm is as good as any other averaged over all fitness functions, including random chance. Therefore, the number is correct. Evolution is not going to help you because it's an algorithm without prior knowledge. Unless you want to calim it actually does have prior knowledge. But in that case you have to explain where it got it.

quote:

---

Why only 10^20 ? That isn't allow for manhy other options at all. If there were a mere 10 possible sequences for each of the 50 proteins that would be a factor of 10^50. And that is going to be a huge underestimate - before even looking at other factors.

---

The best possible estimate is 20% change. That would amount to chnace of 1:10^14770. Therefore, that's still way over 10^120.

quote:

---

Then your question is nonsense. Any information that dis not the produce of design is not CSI by Dembski's definition.

---

That's not the point. We are talking about transmition of CSI here, for which algorithms are very well suited. The question is, is evolution well suited to transmit the CSI from nature into living organisms.

quote:

---

I answered the real point, which is that there is reason to believe that evolution will do better than chance.

---

Yes, you answered it, by simply asserting it. Where is the evidnece evolution can actually do it?

quote:

---

Your misinterpretations are not evidence either. Genetic entropy is only a problem under certain circumstances.

---

What misinterpretations are you talking about? And what "certain circumstances" are you talking about?

quote:

---

No, obviously YOU failed to understand it. Dembski's own explanation starts with observation of a pattern - whih is used to produce the specification.

---

But the point is that not every observed pattern is a specification.

quote:

---

Background knowledge (e.g. knowledge of statues) helps rather a lot.

---

Of course it hels, that is why it's here for.

quote:

---

And again it's an example of background knowledge leading us to prefer a positive design hypothesis over non-design. How unlike Dembski's method which avoids positive design hypotheses like the plague.

---

What are you talking about? What positive design hypothesis is Dembski avoiding?Edited by Smooth Operator, : No reason given.

quote:

---

The Rosetta Stone is a human artifact, made by humans, with human writing on it, in two languages that we were familiar with, from other human artifacts, but did not understand, and one language that we did understand, at the time that it was discovered. There is no doubt that it was designed, by humans.

---

If you were walking down the street one day, and you came across a piece of paper that had written on it "Mark wrote this". Tell me, how would you know htat the person who wrote that was not named John? How would you know, that it wasn't actually a woman? How would you know, that it was not a trained monkey that wrote that? Or when, why and how it was written?If you want to argue that you could know anything what I meantioned above, than you are completely wrong.The same goes for the Rosetta Stone. For all we know aliens could have designed it. How would you know the difference? You wouldn't obviously. We only assume that people did it. And it's a good assumption that is probably about 99.9% correct. But it's still an assumption. And we DO NOT, and I repeat, we DO NOT, know who, when, why and how designed that stone. Yet we still infer design, without knowing the identity of the designer.If you disagree, please tell me, how would you tell apart this Rosetta stone, and an identical one that was made by aliens.

quote:

---

I wouldn't know, nor would I claim to know any of that, nor would any scinetist, if all he had as information was the writing on the paper.

---

Than you do see how the same applies for the Rosetta Stone?

quote:

---

It could have been pooped out by a hippo with three horns on his butt as well....

---

Very unlikely, but yes, it could have. Not only that but it could have just happened by chance. Like you belive that self replicating machinery does.

quote:

---

Yes, that's how science works. We work with the data we have. Since there is no evidence of any aliens ever having visitred this planet, we assume it was created by the only intelligence we know capable of producing it: man.

---

Exactly. And that's called the inference to the best explanation. The best explanation is that a human intelligence did it. But if we are going to go into more general terms, an intelligence did it. Since we do not know which. That humans did it, is after all an assumption.But nevertheless, even thoug we do not actually know who designed the Rosetta Stone, a design inference was made. That is the main point to remember.

quote:

---

We infer that because it has written language on it, we know people used in the past. And we know people wrote on stones.

---

Yes, but let's be more general. What we see on the Rosetta stone is information. And we DO KNOW that intelligence creates information. Therefore, we infer design from the Rosetta stone. And we do the same for DNA because it's information as well. And as I said before, since we DO KNOW that intelligence creates information, we infer the Rosetta Stone, and DNA is designed.

quote:

---

No, nor does anyone claim they would. That's science for ya, tentative. We go with the best assumption we have untill more evidence is available that shows otherwise.

---

So you agree with me that we do not need to know who the designer was to infer design?You infered the Rosetta stone was designed because people write letters. To put it into more general terms, people use intelligence when they write and that's how they create information.So here is my reasoning. Since we know that when intelligence acts, information is created, I infer that whan we find information we found design.So, when we find something like the Rosetta stone, we found something that was designed. The same goes for any information including DNA. The best explanation is that it was designed.

quote:

---

So, if you have evidence for this intelligent designer, show it, and we can then discuss whether or not he designed life on this planet.

---

I just explained it above. Life is based on DNA. DNA is information. Intelligence creates information. Therefore, we infer life was designed.

quote:

---

Untill then we go with the explanation that is simplest: Life arose by natural means and evolved by natural means.

---

Where is the evidnece life can come about naturally?

quote:

---

Actually that isn't certain in this case. Especially when one of the proteins can be entirely absent.

---

Yes, and on average, the change is 20%, all changes included.

quote:

---

Which just shows how little you understand CSI. The definition of CSI ensures that algorithms can't produce it.

---

I know it can't be produced, but it can be transmited by an algorithm. So when we see something we think is designed, the question is is it just expanded by an algorithm, or is it real CSI.

quote:

---

In other words the whole point of the book is to avoid dealing with the real question

---

No, the real question is can CSI be created by an algorithm. The answer is no.

quote:

---

(you have just admitted that I was correct

---

No, I never said that. And you are not correct.

quote:

---

and it is the origin of the mechanisms that grow flagella that is important,

---

What is important is where did they get their information from to grow a flagellum in the first palce.

quote:

---

not the flagellum itself)

---

Yes the flagellum itself too, because it is simply the expanded informatoin stored in the bacteria before it grows the flagellum.

quote:

---

and to misrepresent the NFL theorems as saying that evolution can't work.

---

It's not a misrepresentation. That's how things are.

quote:

---

So you can't do maths either. If we use your 20% figure there are a huge number of substitutions possible for each of the 50 proteins. And you get to multiply them all together because you can use any combination. Of course it doesn't matter because dembski's doing completely the wrong calculation anyway.

---

I just noticed I posted the wrong number. It was supposed to be 1:10^2363. This whole number includes all 50 proteins and all their possible changes.

quote:

---

No, we're talking about WHETHER the flagellum is CSI in the first place.

---

It conforms to an independently given pattern and it's complexity is 10^2363 after we calculated the possible change in the structure. Therefore, yes, it's CSI.

quote:

---

Wrong. I explained why evolution can do better than chance.

---

No, you just asserted it.

quote:

---

The question of whether genetic entropy is a problem for a species depends on the mutation rate and the effective population size. Any idea that it is a general problem outside of the mathematical limits that result from those factors is a misinterpretation.

---

You didn't even bother to click on the link, let alone read the article. The article is an empirical study of the accumulation of mutations. Not just a mathematical model. Here is another one. Not only does it show mutations accumulating, but it shows populations going extinct. I'm sorry you can't get around this. Evolution does not work. Populations die becasue of genetic entropy.

quote:

---

By tracking the fitness decline of ligase ribozyme populations with bottleneck sizes between 100 and 3000 molecules, we detected the appearance and subsequent fixation of both slightly deleterious mutations and advantageous mutations. Smaller populations went extinct in significantly fewer generations than did larger ones, supporting the notion of a mutational meltdown. These data suggest that mutation accumulation was an important evolutionary force in the prebiotic RNA world and that mechanisms such as recombination to ameliorate genetic loads may have been in place early in the history of life.

---

Accumulation of Deleterious Mutations in Small Abiotic Populations of RNA - PMC

quote:

---

No. The point was that "specifications" derived from observed patterns are NOT the same as specifications derived without observation, and Dembski's separability criterion fails to deal with the problem.

---

That is not a problem that is meaningless drivel. How do you intend to acquire knowledge about a pattern unless you observe it?

quote:

---

Thanks for admitting that there is more to dsign detection than Dembski's limited (and often impractical) method.

---

No, I never said that. You keep misinterpreting everything I say.

quote:

---

So you don't understand Dembski's design inference AT ALL ? Why try to defend a method when you don't understand the most basic part of it ? Let's put it simply. When dealing with Mount Rushmore and the Rosetta Stone we immediately form positivie hypotheses about how they were produced. Involving people and chisels, for instance - and we can compare those with the alternatives and see which comes up best. Dembski doesn't do that. Design is left as the default choice with no suggestion about who or how or why. Which is why real design detection has rather less to do with Dembski's methodology than he would like you to believe.

---

This is something that is totally irelevant to design detection, because we do not need to know the tools that were used to design something.Edited by Smooth Operator, : No reason given.

quote:

---

For enzymatic activity.

---

Which is what is going on when proteins interact with other chemicals.

quote:

---

Aside from the amusing juxtaposition, it hardly seems worth writing a book to deal with a matter which trivially follows from the definition of CSI given in a previous book.

---

No it's not. Because something that we see could be a product of an algorithm, yet we mistook it for CSI.

quote:

---

And the contradictions just keep on coming !

​

If you are interested in the information involved in growing a flagellum then you need to look at how it grows. Working on a basis of random assembly ignoring the regularities underlying process is just going to give you the wrong answer.

---

I'm not interested in how it grows. I'm interested in how the bacteria that grows it got the information to grow it in the first palce.

quote:

---

In other words once we account for the information involved in producing the flagellum we've accounted for the information in the flagellum too. That's not a good reason for looking at the flagellum.

---

Yes it is because you have to measure the information first. You have to know what you want to account for. It's like saying that we do not need to account for the information in people's limbs because people grow limbs.

quote:

---

Unfortunately for you, it is a misrepresentation and it isn't how things are.

---

Explain why.

quote:

---

You mean that it includes your estimates for those. Of course there are all those other flagella out in the world to consider, too and the possible variations of those and other ways of producing motion. And even if you included all those you still wouldn't have a number that meant anything because you're ignoring the fact that flagella don't just assemble randomly.

---

No, it's not my estimate. It's Dembski's calcualtion coupled with Axe's research. And no, we are not looking for other flagellums now. We are looking at this one. Other's are irrelavant righ now.

quote:

---

Except that isn't the complexity. You haven't got close to a valid calculation of the complexity.

---

Explain why.

quote:

---

If you wanted to argue that flagella can't grow, so they must be individually assembled by the Intelligent Designer you could claim to have calculated the complexity. You;d be wrong but at least you'd have made a bad attempt at the right calculation. Which is more than you or Dembski have managed for the E coli flagellum.

---

Their gorwth doesn't help you one bit. It doesn't matter how they are assembled. What matters is the amount of information that is required to construct one.

quote:

---

Simply repeating your error doesn't help you.

---

Cite me the part where you showed that evolution works bettern than random search.

quote:

---

And it agrees with what I said. SMALL populations are vulnerable to genetic entropy.

---

No. It doesn't agree with you. You said that genetic entropy is non-existant and that it's a misinterpretation. The article claims that it exists.If you think that larege populations, whatever you define large to be, don't suffer from genetic entropy than you are wrong. It's like saying that 1+1=3. Smaller popultations suffer from entropy moer than larger populations. That's obvious. But that doesn't mean that you will make the the entropy go away by simply increasing the population. The entropy stays.And the reason is becasue all individuals are mutants. And we pass 100% of our genetic material with good and bad mutations. Therefore whoever gets selected, both beneficial nad deletarious mutations stay in the population and accumulate.

quote:

---

You could have a theory that predicts it. This is the way science often works, You take observations to build a theory and then test it against observations that had not previously been made.

---

Hello!? I said without an observatio! You just said that you first have to make an observation.

quote:

---

But that isn't the point. The point is that that since there are many patterns which look designed the probabiblity that you see A pattern that looks designed will always be significantly higher than the probability of seeing the specific pattern that was observed. Dembski originally failed to take this into account, and has yet to adequately deal with the problem.

---

This is a meningless statement. The statement: "Probability of observing patterns that only look designed is higher than observing patterns that are observed" is meaningless.

quote:

---

So you DON'T think that background knowledge is helpful in identifying design. Please make your mind up.

---

Of course it is.

quote:

---

So your reason for saying that background knowledge isn't helpful is that it isn't absolutely essential. Not a very good - or rational - reason.

---

When did I say that?