|
|
Register | Sign In |
|
QuickSearch
| EvC Forum active members: 38 (9287 total) |
|
| |
| Sabbathbreaker | |
| Total: 923,983 Year: 725/3,580 Month: 134/163 Week: 28/72 Day: 11/4 Hour: 2/0 |
| Thread ▼ Details |
|
|
| Author | Topic: The End of Evolution By Means of Natural Selection | |||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
It's not exactly that there were "changes in alleles" but that those alleles that were already available in the original population and probably haphazardly expressed phenotypically at that stage -- quite a few types obviously -- were selected down to a single type for each new population, and in the process all the other beak types were eliminated. Mutations in each generation guarantee that new variation in beaks will continue to appear through time. Also, environments are almost never static so that alleles that were previously driven towards high frequencies may be selected against in the future. So for evolution to end, as you claim, you would require two things. First, mutation must stop. I know of no species that breeds true. All species acquire new mutations in each generation. Second, you need the environment to be completely static. Can you name one environment that doesn't change over time? I can't.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
By the way, mutations do make contributions to breeding. For example, the dachshund's short legs originated through mutation (Scientists discover secret of why dachshunds have short legs).
Percy beat me to it. This is exactly what I was thinking reading this thread. Also, this is a dominant allele. You only need one copy of the mutation to produce the phenotype. If the wolf ancestors of chihuahuas had this DNA sequence then these wolf ancestors would have had short legs like the dachsund. The only way for this to work is for the mutation to occur in the dachsund lineage FIRST and then have it selected for SECOND, a two step process (the first step of which Faith continues to ignore). Also, mutations in the same human gene result in dwarfism as well. Hmf, who would have figured.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined:
|
I don't really want to "debate" I want to sort things out. From reading this thread I get the distinct impression that you need to sort out what mutations are and how they relate to variation. Whether you do this on this thread, on another thread, or in your own research I don't care. However, this does seem to be a big stumbling block where your "theory" is concerned. Perhaps it would help if I describe the problem from the perspective of a biologist. The first thing a biologist runs into when looking at life is the shear diversity of life (i.e. biodiversity). So the first problem is "What makes all of these species different". Starting with Avery it was found that nucleic acids are the molecule involved in heritable traits. Later on Watson, Crick, and Franklin deduced the molecular structure of DNA which allowed us to understand how nucleic acids pass on these traits. As it turns out, differences in nucleotide sequence in DNA is what produces differences between species. The reason that humans are different from chimps is that our DNA sequece is different, by about 2%. The things we have in common with chimps is due to the DNA sequences we share. Commonality in DNA sequence explains the commonalities in phenotype while the differences in DNA sequence explain the differences in phenotype. So how does this relate to DNA mutation? Well, it should be pretty obvious. Mutations change the nucleotide sequence of DNA. Mutations can and do change phenotype. Further observation tells us that every generation has mutations. Every generation is different from the last. The DNA sequence in your cells is unique to you. No other person in the world, past or present, has a genome exactly like yours and this is due to mutation. The only exception is identical twins who are clones of one another. The biologist then has an additional problem to work out. Why do some mutations become more prominent while others disappear? The answer to that is natural selection. The problem you seem to be having is that you ignore the process of mutation. You treat every population as if mutations do not occur.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
What I want to sort out more is the relation of speciation to evolution. This, too, is dependent on mutation. Speciation is the result of DIFFERENT mutations accumulating in two DIFFERENT populations. If mutations were not occuring then speciation would not occur. It is analogous to French and Italian branching off from a common root language and acquiring language specific differences over time to the point that people from the two different populations can no longer understand each other even though they share a common root language.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
Isn't it when the breed is already highly inbred, which allows new (or formerly suppressed) alleles to get expressed? I just wanted to clear this up for Faith's sake. No reply is necessary. In the case of dwarfism in dogs (and in humans) it only requires one copy of the mutated gene. It is a dominant (i.e. not recessive) trait. "[Achondroplasia] is an autosomal dominant disease caused by a mutation in the gene that codes for fibroblast growth factor receptor 3 (FGFR3)."Page not found | Go Pets America
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined:
|
Faith's argument reminds me of an idea I had when I was a child. I thought that if I stood on a rope and then pulled up on the ends of the rope I could make myself levitate. I just couldn't figure out why it wouldn't work. I knew I could lift my own weight. I was baffled.
Of course the solution is quite obvious now. I was ignoring the opposite force created when I pulled on the rope. Faith is making this same mistake. She is ignoring the opposite force in selection, the creation of new alleles by random mutation. To use a different analogy, Faith might as well argue that it should have stopped raining years ago given the limited amount of water the atmosphere can hold all the while ignoring the process of evaporation. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
The YEC believe that they have a direct pipeline to the truth, and therefore potentially know more than mere experts. It might be something a little different than that. Faith has openly admitted that she is trying to falsify Evolution. The experts are doing something quite different. The experts are trying to build a model that accurately portrays how reality works. Presumably, if Faith follows a path of evidence that leads to the conclusion "Evolution is true" then she must stop, retrace her steps, and try again. What Faith is trying to do is find some path that leads to "Evolution not true".
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
Not having a grasp of the whole process doesn't mean that I don't know that mutation refers to various ways parts of the DNA strand are switched around during duplication. Here are the four general types of mutation with the parent DNA on top and the offspring DNA on the bottom: Point mutation: AATTGGCCACTTGGCC Insertion: AATTGGCCAACTTGGCC Deletion: AATTGGCCATTGGCC Duplication: AATTGGCCAATTGGCCAATTGGCC Insertions and deletions (often described by a single term "indel) can involve numerous bases. Duplications can be of a whole gene or part of a gene, or a duplication of non-coding DNA. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
In all that I've simply been more convinced of what I'm trying to say here. Sorry about that, but nothing has changed my mind about it. What evidence, if found, would change your mind?
I have a rough idea of mutation although it's complicated and I'm not terribly interested in it and don't see its relevance for what I'm talking about. If you want to claim that evolution can only reduce variation then you should be interested in evolutionary mechanisms which increase variation. Mutations increase variation. The reason that descendants are different from ancestors is because mutations change the DNA in each generation. Populations that no longer interbreed will accumulate different mutations over time resulting in species that are different.
But I simply don't see its relevance for the project I'm involved in here. Cant' see the relevance, or refuse to see the relevance? That's the question. ABE: Percy wants you to respond in the other thread so only respond to my post if you have time. Admins, please feel free to delete my message if it is a problem. You have my permission. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
From the opening post:
"My argument is that natural selection and genetic drift, all the processes that select or isolate a portion of a population, do bring about the change called evolution but also always reduce genetic variability, which is the opposite of what evolution needs." So you are arguing that evolution needs a source of new variation, a mechanism that introduces new alleles. Mutations do just that. Mutations refute your opening argument. Mechanisms which refute your claims would seem to be relevant.
Evidence that would convince me: evidence of an increase in genetic diversity at speciation. I thought we were talking about the evolutionary process as a whole, and how it could not increase variation over time? Speciation is just one step in the process.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
It isn't a simple additive process. The subtractions that lead to speciation lay waste to all the additions you can come up with. That's completely wrong. A speciation event does not re-establish the genome of a distant ancestor, and it does not force the two new species to have the same mutations. If a mutation occurs in chimps it does not occur in humans just because it occurs in chimps. Furthermore, a mutation that is selected for in chimps may or may not be selected for in humans. The genomes of humans and chimps will continue to diverge over time just as evolution predicts. No future speciation event will cause the chimp or human genomes to become identical to the genome of their common ancestor. Those differences are there to stay. There is no way to reverse them.
Prove that there's an increase in genetic diversity AT speciation. Why should I prove something that I have never claimed? I fully agree that natural selection reduces the number of alleles, including speciation events. However, evolution is not just natural selection and speciation. There is a third mechanism: mutation. Over time these mutations are additive. There is nothing to stop it. Or perhaps you can tell us the mechanism that will rid you of the 100 to 200 mutations that you carry? How does evolution prevent you from passing on these 100-200 mutations to your offspring, and how does it stop an additional 100-200 mutations from occuring in your children? What is stopping this process in any human out there?
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined:
|
A challenge for Faith:
Please explain why it hasn't stopped raining in human history given the limited amount of water that the atmosphere can hold. Also remember that evaporation of surface water is irrelevant to this argument.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
The diversity of phenotypes is the result of the reduction of alleles due to the reduced population. The reduced number of alleles corresponds to a reduced number of traits available of course, but the observed increase in diversity of phenotypes in the new population is due to many NEW traits having opportunity of expression which wasn't possible in the original population. That is not true for dwarfism in dogs such as dachsunds. This required a mutation in a gene, a mutation not present in the parent population. This has been pointed out numerous times. Also, do you think the differences between humans and chimps is due to expression of recessive genes in both populations? Or is it due to differences in the DNA sequences themselves?
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined:
|
Kinda the same way Dawkins would be convinced of the falseness of evolution if a rabbit were found in the precambrian, which is the opposite of what creationism would predict too. It's not the same at all, and you know it. Dawkins said he would REJECT the theory if something was found which the theory did NOT predict. You are saying that you will ACCEPT the theory if something is found which the theory did NOT predict. They are exact opposites.
If there is such a thing as speciation that is not dependent on reduced genetic diversity then you could convince me that evolution is possible. Speciation is just one mechanism of many that, in combination, causes evolution. If you want to falsify evolution then you must show how all of the mechanism in combination will not produce evolution. You must show how mutation does not increase genetic diversity. You have not done that. The problem here is that you are trying to falsify YOUR theory of evolution, not the theory proposed by scientists. The "Faith" theory of evolution is missing a lot of mechanisms such as neutral drift and mutation. I will glady agree that the Fiath theory of evolution will not produce evolutionary change. However, you have yet to show that the theory of evolution proposed by millions of scientists is false in the same way.
|
|||||||||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10563 Joined: |
Fine, I anticipated arguments along those lines. Produce one so I can take a look at it. Random mutations. You know, that thing you keep ignoring which increases genetic diversity. Let's start off with some questoins so we can at least find some common ground. Do you agree or disagree that mutations occur? Do you agree or disagree that mutations from one generation are passed on to the next? Do you agree or disagree that the differences between species is due to a difference in DNA sequence? Those three questions should be enough.
|
|||||||||||||||||||||||||||||||||||||||
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2026
