Register | Sign In


Understanding through Discussion


EvC Forum active members: 64 (9164 total)
2 online now:
Newest Member: ChatGPT
Post Volume: Total: 916,832 Year: 4,089/9,624 Month: 960/974 Week: 287/286 Day: 8/40 Hour: 0/4


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Micro v. Macro Creationist Challenge
Taq
Member
Posts: 10077
Joined: 03-06-2009
Member Rating: 5.1


(2)
Message 1 of 2 (809966)
05-22-2017 12:55 PM


For creationists who claim that microevolution and macroevolution are two different things, here is a simple challenge:
Show us a single genetic difference between the human and chimp genome that could not have been produced by known microevolutionary processes in either the chimp or human lineages.
Just for clarity, I am defining a microevolutionary change as a single mutational event (e.g. base substitution, insertion, deletion, transposon insertion, retroviral insertion, or genetic recombination) that is passed on to descendants.
As an example, here is a comparison of portion of the human HNF1 homeobox A gene and the homologous chimp gene:
Query  1     GGCCCTGTGGCAGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGG  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1100  GGCCCTGTGGCAGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGG  1159

Query  61    CGGCCCTGCTGGAGTCAGGGCTGAGCAAAGAGGCACTGCTCCAGGCACTGGGTGAGCCGG  120
             |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct  1160  CGGCCCTGCTCGAGTCAGGGCTGAGCAAAGAGGCACTGATCCAGGCACTGGGTGAGCCGG  1219

Query  121   GGCCCTACCTCCTGGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTC  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1220  GGCCCTACCTCCTGGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTC  1279
The human sequence is on top, and the chimp sequence is on the bottom. The "|" symbols indicate where the two sequences are the same. As you can see, there are two base substitutions in the middle row.
Can any creationist give us a single reason why two microevolutionary events could not produce those two base differences? Can creationists point to any different in the chimp and human genomes that could not be produced microevolution?
To admin: Would prefer placement in the Biological Evolution forum.
Edited by Taq, : No reason given.
Edited by Taq, : No reason given.

AdminNosy
Administrator
Posts: 4754
From: Vancouver, BC, Canada
Joined: 11-11-2003


Message 2 of 2 (809972)
05-22-2017 2:15 PM


Thread Copied to Biological Evolution Forum
Thread copied to the Micro v. Macro Creationist Challenge thread in the Biological Evolution forum, this copy of the thread has been closed.

Newer Topic | Older Topic
Jump to:


Copyright 2001-2023 by EvC Forum, All Rights Reserved

™ Version 4.2
Innovative software from Qwixotic © 2024