What Barrier is Stopping Macroevolution?

Some ID/creationists claim that microevolutionary changes can't produce macroevolutionary change. Let's see if that claim stacks up.First, let's define the scientific terms within the context of the data I am going to present.Microevolution: a single mutation eventMacroevolution: the differences between the genomes of two organisms from two different separately created kinds, as proposed by ID/creationistsIf the ID/creationist argument is correct, then there must be some sort of quantitative difference between microevolution and macroevolution. That is, there should be some sort of objective and demonstrable dividing line between single mutations and the differences seen between two genomes from separately created kinds.What is the process proposed by macroevolution? It is the accumulation of single mutations. Let's start with some short sequences and then work our way up.Step 1
We begin with an interbreeding population, otherwise known as a species. They have a shared stretch of DNA in their genome with the sequence ttttttttt.Step 2
A huge river changes course and now runs down the middle of the region where this species is found. It is wide and fast enough that individuals aren't able to cross it. We now have two isolated populations, but that shared stretch of DNA still has the same sequence in both populations. We will call them PopA and PopB. Step 3
In PopA, a substitution mutation occurs in that shared stretch of DNA and spreads through the population of PopA, so now we have: Step 4
In PopB, the same thing happens. A substitution mutation spreads through the population. Now we have: Step 5
In PopB, a deletion mutation removes two of the bases from that stretch of DNA and this deletion mutation spreads through the population. We now have: So what would stop this process from happening over and over and over?Let's look at an actual comparison of two genomes. The sequence on top is human DNA sequence from a portion of the mmp3 gene. Below the human DNA sequence is the orthologous DNA from the chimp genome, and between the two sequences are | representing a matching base between the two genomes. There are 11 base differences between the two genomes, 9 substitution mutations and one insertion/deletion (i.e. indel). This gives us an overall similarity of 97.25%. According to the concept of separately created kinds, the differences between the human and chimp genomes could not be the result of an accumulation of individual mutations. In other words, when they say they don't accept macroevolution they are saying they reject the idea that evolution can produce the differences seen between the human and chimp genomes.
​
So how is that? Which of those differences could not be the result of accumulated mutations like those we see in PopA and PopB?The section of chimp/human DNA I decided to use is most likely intron sequence. I did this because it had more mutations in a small number of bases which keeps the clutter to a minimum. However, if anyone thinks this sequence is inappropriate for the discussion, then they are free to use any section of DNA they like. I am using the UCSC genome browser to look through the latest build of the chimp genome:UCSC Genome Browser GatewayIf someone wants to follow the steps I used:
I entered "mmp3" into search bar, and then clicked on the "MMP3" hyperlink. I changed the "Human Chain/Net" option to "full" in the Comparative Genomics section, hit refresh, clicked on the bottom alignment within the new track (colored yellow on my screen), and then selected the "DNA sequence alignment" hyperlink on the subsequent page. Clicking on the "together" hyperlink on the subsequent page will give you the view I used above.I am hoping that ID/creationists will cite actual sequence from the human and chimp genomes to illustrate any claims they may have. With the UCSC genome browser, it should be a straightforward process for them to show at least some of the sequence differences they think precludes macroevolution.NOTE:Also, you will need to use dbcodes codes to make these alignments readable on EvC, so use the peek button below to see the codes I used. Specifically, I am using the [code]sequence[/code] dbcode to bracket sequence. You can also use [code]sequence[/code=20] to limit the code box to just 20 visible lines and enable a scroll bar.

For admin:The "Biological Evolution" forum would the be most appropriate home for the thread, IMHO.I know there haven't been that many creationists around as of late, but I have always wanted to start a thread like this one, especially given the ease of access to genome sequences in modern times. If the thread starts to die a lonely death, hopefully we can bring this thread back to life if newcomers find it interesting.

You can use [code], too, which uses the Courier font by default. It also adds a horizontal scroll bar if it gets wider than the displayed page.You can get a vertical scrollbar, too. For example, [code=20] adds a vertical scrollbar if there are more than 20 lines.I didn't follow this part: If humans and chimps were created separately then wouldn't creationists have no need to explain macroevolution?

quote:

---

You can use code, too, which uses the Courier font by default. It also adds a horizontal scroll bar if it gets wider than the displayed page.
​
You can get a vertical scrollbar, too. For example, code=20 adds a vertical scrollbar if there are more than 20 lines.

---

I had issues getting the correct font in the code sections. Need something like courier so the sequences visually line up.

102836535 acacagccagattccaggttacagggttattctgcttccgatcagataaa 102836584
>>>>>>>>> |||||||||| |||||||||||| |||||||||||||||||||||||||| >>>>>>>>>
098675847 acacagccaggttccaggttacaaggttattctgcttccgatcagataaa 098675896
​

Agreed, that is poorly worded. New version:

quote:

---

According to the concept of separately created kinds, the differences between the human and chimp genomes could not be the result of an accumulation of individual mutations. In other words, when they say they don't accept macroevolution they are saying they reject the idea that evolution can produce the differences seen between the human and chimp genomes.

​

So how is that? Which of those differences could not be the result of accumulated mutations . . . and so on

---

Does that make more sense?

Unless there's some obscure bug in play, [code]uses the "Courier New" font by default. This is using [code]with no [face=courier new]:

102836535 acacagccagattccaggttacagggttattctgcttccgatcagataaa 102836584
>>>>>>>>> |||||||||| |||||||||||| |||||||||||||||||||||||||| >>>>>>>>>
098675847 acacagccaggttccaggttacaaggttattctgcttccgatcagataaa 098675896

If you're not seeing that then there must be a bug somewhere that's context dependent, perhaps different browsers. Yep, perfect sense. If you make that substitution in the opening post I'll promote it.

It looks like you squashed the bug, as detailed in another thread. I changed everything over to the [code][/code] usage and gave specific instructions on how to use them. As a bonus, I also learned how to use the noparse code. Changes made, and awaiting approval.

Thread copied here from the What Barrier is Stopping Macroevolution? thread in the Proposed New Topics forum.

That is a pretty tall order there Taq.Look at your message:

quote:

---

There are 11 base differences between the two genomes, 9 substitution mutations and one insertion/deletion (i.e. indel). This gives us an overall similarity of 97.25%.

---

Real ID/creationists do not know what half those words mean.Then you want them to manipulate data? Seriously? That involves math. Now I know they can try to call on Jesus for help but that still means some hard math for someone.

Since we are saying the quiet parts out loud (and probably won't get any takers anyway), that's what I suspect as well. I am using the most basic terminology used in genetics, so any ID/creationist who claims to be using the same evidence as everyone else should be able to parse what I posted.Surely they have already compared these sequences and found the differences that couldn't evolve, right? If they are using the same evidence as evolutionists then surely they have found specific differences that demonstrate new information, right? [/sarcasm]What you, I, and the rest of the actual scientific community think is that Intelligent Design is nothing more than Christian apologetics with a thinly veiled attempt to disguise it with sciency sounding words. The difference between ID and an actual scientific theory like the theory of evolution is that real scientific theories start with the data. The entire point of science is to explain the data. ID/creationism never deals with the data because that is not the point of ID/creationism. It is Christian apologetics and is meant to make Christians feel justified in rejecting evolution. This is why nearly all ID/creationist arguments boil down to rhetoric and semantics while ignoring the actual data.Of course, I am willing to be proven wrong, hence this thread.