To K.Rose: If you didn't understand Taq's response in Message 542 then you're not alone. I had to work my way through it. I never recall which nucleotides are paired in DNA, so I had to look up that the A and T nucleotides always pair together, and the C and G nucleotides always pair together. Nucleotides are also called bases. Taq begins with this:
1. Background information: We observe mutations happening in humans by comparing up to three generations of parents and offspring. When we categorize these mutations we put them into 4 buckets due to different factors, such as DNA being double stranded. Those buckets are: 'T<>C/G<>A', 'G<>C', 'A<>T', and 'A<>C/G<>T'. Just to make this clear, a mutation of a G to an A would fall into the first bucket, as would a A to a G, C to a T, or a T to C. A G to a C or a C to a G would fit into the 2nd bucket.
Taking the simple cases first, what Taq called the A<>T bucket means that you begin with an A/T nucleotide pair and either the A is replaced with a T, or the T is replaced with a A. Either way, the A/T pair becomes a T/A pair, or a T/A pair becomes an A/T pair. It could be expressed like this (there's probably a standard way of expressing this, but this isn't my field and I have no idea what that might be):
A===T ↓ T===A
or
T===A ↓ A===T
And this is a mutation corresponding to the G<>C bucket where a C becomes a G or vice versa:
C===G ↓ G===C
or
G===C ↓ C===G
You can see that all that is happening in the above two examples is that nucleotides are just transposed, i.e., exchange positions.
The T<>C/G<>A bucket contains two cases instead of one. A T might become a C, or a G might become an A. Here's the T becoming a C case (or vice versa, just go from the bottom up instead of the top down):
T===A ↓ C===G
And here's the G becoming an A case (or vice versa):
G===C ↓ A===T
The remaining bucket is A<>C/G<>T, and here are examples of A becoming C (or vice versa):
A===T ↓ C===G
And G becoming T (or vice versa):
G===C ↓ T===A
Taq next says:
If there were an equal chance of a base mutating into one of the 3 other bases then we can predict what the pattern should be. In fact, I wrote a Python script that ran a simulation of 2,200 mutations across 60 million bases in a genome with 41% GC content which is the case in humans (41% of the sequence is GC while 59% is AT) and across 4 trials. Here are my results:
T<>C/G<>A
0.342
+/- 0.0081
G<>C
0.133
+/- 0.0083
A<>T
0.193
+/- 0.0095
A<>C/G<>T
0.332
+/- 0.0073
I understand data better if it's in nice neat columns, so that's what I did to Taq's results table. I also removed the unneeded precision. I sanity checked these values myself just applying probability and got the same numbers. For G<>C I got .137 (.59*.5*(1/3)*2), well inside his experimental error. For A<>T I got .197 (.41*.5*(1/3)*2). For both the T<>C/G<>A and A<>C/G<>T buckets I got .333 (1/3) *(.59*.5+.41*.5+.41*.5+.59*.5). So his Monte Carlo figures are fine.
But what happens when we analyze actual human DNA for mutations? We find different numbers, numbers that tell us that the odds for which base changes into which other base are not equal. One type of transition dominates, as illustrated here:
Looking at just that first bucket, why is the T<>C/G<>A bucket nearly 70% of all mutation types, instead of the Monte Carlo'd and calculated 1/3. Taq explains this as due to the process of methylation and deamination being more likely because of cytosine's and thymine's chemical similarity, but I don't think these details are important to us laypeople.
What's important is that the above chart shows the actual likelihood of the different types of mutations in humans. Taq then advances the hypothesis that if de novo mutations in humans have these likelihoods then if humans and chimps are descended from a common ancestor then the mutational differences between human and chimp DNA should show the same proportions. And that's exactly what we see as shown in this chart:
Making this prediction and then seeing it born out gives us confidence that humans and chimps are descended from a common ancestor.
But it might actually show much more than that, because (if I actually understand this, which could easily not be true) then the same proportions should show up in the mutation types of DNA differences between any two species, say human/horse or cat/raccoon or fish/snake. It would be evidence of the relatedness of all life. But Taq would have to comment on that before I'd trust that conclusion. There could be other factors affecting mutations that come into play.
I met Stephen Jay Gould before a lecture at Oregon State University years ago. I got to the lecture hall about 30 minutes early because I wanted a seat in the front row. He and his son came in shortly after I got there and we talked for about 15 minutes. I told him about my interest in dragonflies and he spent the rest of the time asking me all about dragonflies. His lecture was shortly after Wonderful Life was published so the focus was, if you reran history life would be completely different each time. He was one hell of a lecturer!
Stop Tzar Vladimir the Condemned!
What if Eleanor Roosevelt had wings? -- Monty Python
One important characteristic of a theory is that it has survived repeated attempts to falsify it. Contrary to your understanding, all available evidence confirms it. --Subbie
If evolution is shown to be false, it will be at the hands of things that are true, not made up. --Percy
The reason that we have the scientific method is because common sense isn't reliable. -- Taq
Why should anyone debate someone who doesn't know the subject? -- AZPaul3
Gould was one of my favorite writers. Around 25 years ago I was playing at Harvard's indoor tennis facility once a week, just across the river from the campus itself. I could have gotten over there and tried to watch a lecture or even meet him. There was no way to know he would die young.
Taking the simple cases first, what Taq called the A<>T bucket means that you begin with an A/T nucleotide pair and either the A is replaced with a T, or the T is replaced with a A. Either way, the A/T pair becomes a T/A pair, or a T/A pair becomes an A/T pair.
I think it makes more sense when you are comparing two sequences. For example:
TACTTCGCATGCACTGGTTT :species A --------*----------- TACTTCGCTTGCACTGGTTT :species B
Those two species differ at one base in this sequence. So what was the mutation? Well, it could have been a T mutated to an A in species A or an A mutated to a T in species B. That's why this type of mutation is called a T<>A because it could be either one.
We also have to take into account that DNA is double stranded with the complementary sequence on the other strand. Since one strand is copied to make the other strand, the mutation could happen on either strand. In the case of the difference above, since A and T are complementary it would be a T<>A no matter what strand the mutation occurred on.
TACTTCGCATGCACTGGTTT ATGAAGCGTACGTGACCAAA :species A --------*----------- TACTTCGCTTGCACTGGTTT ATGAAGCGAACGTGACCAAA :species B
Let's look at a different mutation.
TACTTCGCATGCACTGGTTT :species A -----*-------------- TACTTAGCATGCACTGGTTT :species B
Here we have a C to an A or an A to a C. However, this mutation could have happened on the other strand as well.
TACTTCGCATGCACTGGTTT ATGAAGCGTACGTGACCAAA :species A -----*-------------- TACTTAGCATGCACTGGTTT ATGAATCGTACGTGACCAAA :species B
Once we take both strands into account we could have had a T to a G, a G to a T, an A to a C, or a C to an A, or A<>C/T<>G. All four of these mutations would have produced the difference we see between the species, so we lump them together into one bucket, the fourth bucket to be precise.
Does that make sense?
I understand data better if it's in nice neat columns, so that's what I did to Taq's results table. I also removed the unneeded precision. I sanity checked these values myself just applying probability and got the same numbers. For G<>C I got .137 (.59*.5*(1/3)*2), well inside his experimental error. For A<>T I got .197 (.41*.5*(1/3)*2). For both the T<>C/G<>A and A<>C/G<>T buckets I got .333 (1/3) *(.59*.5+.41*.5+.41*.5+.59*.5). So his Monte Carlo figures are fine.
Thank you for adding that. I thought about including it, but the post was already getting long.
Looking at just that first bucket, why is the T<>C/G<>A bucket nearly 70% of all mutation types, instead of the Monte Carlo'd and calculated 1/3. Taq explains this as due to the process of methylation and deamination being more likely because of cytosine's and thymine's chemical similarity, but I don't think these details are important to us laypeople. What's important is that the above chart shows the actual likelihood of the different types of mutations in humans.
As you mention later, this is what we observe in humans. These are the measured ratios of different types of mutations. I just wanted to stress this point.
But it might actually show much more than that, because (if I actually understand this, which could easily not be true) then the same proportions should show up in the mutation types of DNA differences between any two species, say human/horse or cat/raccoon or fish/snake. It would be evidence of the relatedness of all life. But Taq would have to comment on that before I'd trust that conclusion. There could be other factors affecting mutations that come into play.
And indeed it does. Stephen Schaffner over at BioLogos did these same comparisons with one tiny twist. He normalized for the 59% bias towards AT content, so he gives a rate instead of a proportion. However, it's the same comparison. He also relabels T<>C/G<>A as transitions, which they are. credit Testing Common Ancestry: It’s All About the Mutations - BioLogos
But it might actually show much more than that, because (if I actually understand this, which could easily not be true) then the same proportions should show up in the mutation types of DNA differences between any two species, say human/horse or cat/raccoon or fish/snake.
I covered the differences between other species above, but there is at least one additional "it might actually show much more than that".
Above, I lumped all transition mutations together. However, CpG transition mutations happen at a much higher rate than other types of mutations:
Just to review, a CpG is a two base sequence of CG, so anywhere you find a CG in a DNA sequence that is a CpG. The p refers to the phosphate that connects the bases on the DNA strand. The C in CpG's can be methylated, and that methyl group makes them prone to deamination into a T.
As discussed before, I used a Python script to create a random DNA sequence. The script creates CpG's wherever the random process creates them. If I look at just one sequence I see that 4.2% of the sequence is made up of CpG's. This is what we would expect from a randomly created sequence where 41% of the sequence is either a C or a G, just as it is in humans.
So what does the actual human genome look like? More importantly, what would we expect the human genome to look like knowing that CpG mutations happen at such a high rate?
We would hypothesize that the human genome would have far fewer CpG's than we would expect from a random sequence. So is that the case?
quote:The total number of CpG sites in human genome comprises around 28.3 mln instances [1]. That is less than 1% of genome compared with 4.4% expected given 42% GC content due to C- > T mutation shift following the frequent 5′ cytosine deamination in CG doublet [2]. Genomic landscape of CpG rich elements in human - PMC
So instead of the human genome being made up of 4.4% CpG's as would be expected from an equal distribution of bases, we instead see less than 1%. This is exactly what we would expect to see if the human genome is the product of evolutionary mechanisms that include the known and observed high rate of CpG transition mutations.
In a nutshell then, we assume that the present results from the past, without fully understanding the process in between, and then apply present processes to explain the past, such that it fits our theory of the process in between.
But this isn't what happened. Rather than assuming that the present results from the past, scientists gradually figured out how the processes of the present gave rise to what they discovered about the past.
Go back to the start of the 17th century and the prevailing view was that the world was unchanging, but as people began to develop the science of geology they discovered that the layers of the Earth occurred in predictable orders and these layers could be identified by characteristic fossils within them. At the time, people still believed that fossils were spontaneously generated within the ground rather than being the remains of long dead animals.
The chap who figured out what they actually were was one Nicholas Steno, who looked a bit like this portrait, painted many years after his death:
Incidentally, you might immediately notice the prominent cross hanging about his neck - that's because he went on to become a bishop after his groundbreaking (literally!) geological work. His seminal 1669 work De solido intra solidum naturaliter contento dissertationis prodromus (that's Preliminary discourse to a dissertation on a solid body naturally contained within a solid in English, gotta love old book titles!) laid down four principles about stratigraphy that are still basically held to today:
The Law of Superposition: which states that, in an undisturbed sequence, the oldest strata (that's the technical word for the layers that the Earth is composed of) are found at the bottom of the stack.
The Principle of Original Horizontality: which states that each stratum was horizontal when first formed.
The Principle of Lateral Continuity: which states that each stratum must have had something that bounded it, or covered the entire Earth.
The Principle of Cross-Cutting Relationships: which states that if a body or discontinuity cuts across a stratum then it must have been formed after the stratum.
It didn't take long for these ideas to become widely accepted, not because they are based upon some assumption but because they match very well indeed with what can be observed in the world, and because they make simple logical sense.
Of course, people still believed that all this was the result of God's creation, perhaps best expressed by William Whiston's A New Theory of the Earth, published in 1696, which described at length how all that was described in the Creation accounts in Genesis matched with what was observed in the geological record. Over time more and more details of geology were figured out by a procession of scientists over the following decades and centuries. Don't worry, I shan't attempt to enumerate them all here, just pick out a few key players.
The next is Abraham Gottlob Werner, a German geologist who did fantastic work in creating detailed records of the rocks across Europe, and for some dramatically wrong theories about how they formed ("Neptunism" which posited that basalts precipitated out of a global ocean). All this work on rocks, by the way, was of huge interest to people of the time because understanding the stratigraphy of a region allows the successful prediction of where coal deposits can and can't be found - something of great interest to the industrialists of the era. This is something that only works because these layers were laid down in order over time, and because the coal deposits of the world nearly all date to a single 60 million year period of the Earth's history (the Carboniferous) which marks the period between when trees first evolved and when fungi capable of efficiently digesting lignin evolved. This means that if you know that the surface rocks of the world are older than the Carboniferous you won't find coal beneath them.
The idea that the past can be explained by invoking present processes didn't obtain popularity until one James Hutton entered the scene, a Scottish polymath, his studies of the geology and geography of Scotland led to him developing his theory of uniformitarianism, published in his 1785 work Theory of the Earth which posited that the Earth had been around for vastly longer than was supposed by people of the time. Hutton, incidentally, believed that the Earth was being maintained in a state suitable for humans by a divine power. Bit-by-bit, Hutton's theory of geology, based primarily on volcanic activity and erosion (aka "Plutonism") gradually pushed out Neptunism as the evidence for it was much stronger.
By this time it was obvious to anyone who had studied the geological record that the animals present in the earliest strata were quite different from the animals of the present day and to the animals to the many other strata in between. But in contrast to Lamarck, a man named Georges Cuvier believed that rather than showing change between forms (evolution) than these different animals were different epochs of life separated from each other by vast catastrophes, and rather than the strata representing the slow action of time - as per Hutton - he believed that they were primarily formed in these catastrophes.
At last, in 1830, we come to Charles Lyell's Principles of Geology, which outlines in painstaking detail how the geology of the past could be explained by the slow action of processes that can still be observed today finally did for Cuvier's theory of Catastrophism. I have a later edition sitting on the shelf to my right, along with his rather more accessible Student's Elements of Geology, and it really is striking how much of what he wrote still stands up today, as does his pithy statement that "the present is the key to the past".
Well over a century of research, careful observation, and passionate debate led to that conclusion, and it would be some decades more before Lyell was universally accepted. It wasn't an assumption, it was the result of painstaking observation.
And it's that same painstaking observation that lead to the recognition of the times that uniformitarianism is not true, such as when a comet struck the Earth around 65 million years ago, and led to the extinction of all the non-avian dinosaurs. Again, not assumption, observation.
When it comes to genetics I agree with natural selection, but I reject the notion that man has descended from some ancient creature (common descent theory). To the evolutionist these two are one in the same, i.e., the evidence for one equals the evidence for the other. However, these are clearly two separate aspects of genetics. Natural selection can be observed and measured repeatedly. Common descent cannot. The evolutionist can call this natural-selection-acceptance and common-descent-rejection anti-science, but it’s a reasonable “show me” expectation of demonstrating a claim.
I apply this same “show me” standard to the various aspects of chemistry, physics, geology, material dating, or dairy farming. If I’m presented with an aspect that cannot be demonstrated repeatedly then I will usually remain objectively open to it unless I have reason to reject it. Common descent cannot be demonstrated repeatedly, and I have reason to reject it.
I appreciate your admonition to get educated, but I’ll point out once again that I’m not here to prove/disprove anything. The burden of proof is on the claimant, and I am asking for the “show me” proof of common descent. I see plenty of paper studies, diagrams, and credentialed assertions, but no concluding proof.
The discussion of courts and schools is a pointless distraction for another forum, and I apologize for perpetuating this, but I must clarify that I do not support mandatory Bible class for schoolchildren. Using man’s law to compel Biblical Faith is profoundly anti-Biblical.
Of course no one here sees it as circular because they see common descent as factual, rather than a proposition in need of proper validation. It's not that either end of the circle is wrong, necessarily, it's that neither end is proven.
Donald Rumsfeld sometimes get credit for pointing out that, in military endeavors, there are known knowns, known unknowns, and unknown unknowns. This can be applied to pretty much everything in life, to technical designs/theories in particular:
1. The knowns are reliable data and established processes/properties that can be applied.
2. The known unknowns are the risks we wish to mitigate, the problems we wish to solve.
3. The unknown unknowns are everything else, starting with the things we haven’t considered.
Our paper design/theory addresses #2, but it must be validated with physical, repeatable testing.
Addressing and dismissing the unknown unknowns in #3 can only be accomplished with physical, repeatable testing. The more testing in more varied conditions that is done, the greater the uncertainty removed.
Common descent theory has plenty of known and unknown uncertainty to address. We can choose to look past the uncertainty or we can physically, repeatedly test. Paper studies are not the test, they are the framework for the test procedure. And drawing conclusions from “test sample results” of unknown origin or uncontrolled processes is not reliable testing.
When it comes to genetics I agree with natural selection, but I reject the notion that man has descended from some ancient creature (common descent theory).
Are we to conclude that no amount of evidence will ever change your mind?
To the evolutionist these two are one in the same, i.e., the evidence for one equals the evidence for the other.
What are you basing this on? Nowhere has anyone said that the existence of natural selection indicates common ancestry.
Natural selection can be observed and measured repeatedly. Common descent cannot. The evolutionist can call this natural-selection-acceptance and common-descent-rejection anti-science, but it’s a reasonable “show me” expectation of demonstrating a claim.
A forensic scientist doesn't have to witness a crime in order to gather evidence for what happened at a crime scene. We are using the scientific method to determine what happened in the unobservable past in the very same way.
Common ancestry is the hypothesis. In the scientific method, you do not observe the hypothesis. That you keep asking for observations of the hypothesis demonstrates that you don't understand how science works.
The evolutionist can call this natural-selection-acceptance and common-descent-rejection anti-science, but it’s a reasonable “show me” expectation of demonstrating a claim.
I have shown you.
First, if common ancestry is true then complex animals should fall into a nested hierarchy. They do. Evidence for common ancestry shown.
Second, if species share a common ancestor and if mutations are responsible for the differences between their genomes then we should see a specific pattern of transition and transversion mutations. We do. Evidence for both common ancestry and mutations shown.
Third, if species share a common ancestor and if natural selection acted upon their genomes then we should see more differences in introns than in exons. We do. Evidence for common ancestry and natural selection shown.
No one is saying that because we see natural selection that common ancestry is true. What we are saying is that seeing a nested hierarchy, seeing a specific pattern of transitions and transversions, and seeing a specific pattern of sequence conservation in introns and exons is evidence for common ancestry and for the various mechanisms of evolution.
I appreciate your admonition to get educated, but I’ll point out once again that I’m not here to prove/disprove anything. The burden of proof is on the claimant, and I am asking for the “show me” proof of common descent. I see plenty of paper studies, diagrams, and credentialed assertions, but no concluding proof.
Those are the concluding proof, beyond any reasonable doubt.
Of course no one here sees it as circular because they see common descent as factual, rather than a proposition in need of proper validation.
Common descent is validated by:
1. Nested hierarchy 2. Transitions outnumber transversions 3. More differences in introns than exons
I can also include more validating evidence if you want, such as shared endogenous retroviruses.
1. The knowns are reliable data and established processes/properties that can be applied.
That's exactly what I have shown you in post after post after post.
Common descent theory has plenty of known and unknown uncertainty to address. We can choose to look past the uncertainty or we can physically, repeatedly test.
That's exactly what has been done. We have tested for:
1. A nested hierarchy 2. A specific pattern of transition and transversion mutations. 3. A specific pattern of sequence conservation in introns and exons.
And drawing conclusions from “test sample results” of unknown origin or uncontrolled processes is not reliable testing.
All of the results I have given you are from known origin and controlled processes.
Your sudden switch towards honesty is a relief. I do hope you can maintain it.
I apply this same “show me” standard to the various aspects of chemistry, physics, geology, material dating, or dairy farming. If I’m presented with an aspect that cannot be demonstrated repeatedly then I will usually remain objectively open to it unless I have reason to reject it.
OK, let's apply your "show me" standard to the question of whether apple seeds can grow into apple trees which bear apples that contain seeds for growing more apple trees. Has anybody you know ever personally observed a seed grow into tree that bears fruit? No, they have not.
So here's a "reasonable" assignment for you to be completed by the end of day tomorrow:
Open an apple and remove all the seeds. Now plant them. Please note that I'm making it easier for you since not every seed can germinate (the figure I've heard for seeds being able to germinate is 50%). This way, at least one seed should germinate and grow into a tree.
Sit there and observe that at least one seed sprouts and grows into a tree.
Observe that tree mature and bear fruit.
Pick one of the apples and cut it open to reveal its seeds.
Present that apple and seeds to me by end of day tomorrow.
Then of course you will need to plant those seeds to prove that they can similarly grow apple trees. I'll give you another week for that stage of the proof.
That certainly seems doable to me (ie, by following your own standards, expectations, and demands). So why can't you do it? Can you explain why you cannot do it? Can you give us any reason why you cannot accomplish that simple "reasonable" task?
Then of course you will need to plant those seeds to prove that they can similarly grow apple trees. I'll give you another week for that stage of the proof.
Wait, first you need to do the in between part. Has anyone ever actually shown that trees come from seeds. This has to be proven repeatedly before we can go any further. I mean talking about trees and apples and seeds, those are just words.
Stop Tzar Vladimir the Condemned!
What if Eleanor Roosevelt had wings? -- Monty Python
One important characteristic of a theory is that it has survived repeated attempts to falsify it. Contrary to your understanding, all available evidence confirms it. --Subbie
If evolution is shown to be false, it will be at the hands of things that are true, not made up. --Percy
The reason that we have the scientific method is because common sense isn't reliable. -- Taq
Why should anyone debate someone who doesn't know the subject? -- AZPaul3
quote:
When it comes to genetics I agree with natural selection, but I reject the notion that man has descended from some ancient creature (common descent theory). To the evolutionist these two are one and the same, i.e., the evidence for one equals the evidence for the other.
This is a clear misrepresentation. The evidence for natural selection is important in the conclusion of common descent because it is one of the processes involved. The main evidence for common descent comes from morphological and genetic similarities and from the fossil record - as well as the fact that this evidence fits into a much larger pattern. As you should have seen in this discussion the evidence for natural selection was cited against your - false - claim that evolutionists believed in unknown and unverified processes.
quote:
I apply this same “show me” standard to the various aspects of chemistry, physics, geology, material dating, or dairy farming. If I’m presented with an aspect that cannot be demonstrated repeatedly then I will usually remain objectively open to it unless I have reason to reject it. Common descent cannot be demonstrated repeatedly, and I have reason to reject it.
I rather suspect that this means that you reject common ancestry because you can’t personally witness tens of millions of years worth of evolution. If you were prepared to take a reasonable stance the evidence - as I said above - is widespread and the same observations may be repeated.
quote:
The discussion of courts and schools is a pointless distraction for another forum, and I apologize for perpetuating this, but I must clarify that I do not support mandatory Bible class for schoolchildren. Using man’s law to compel Biblical Faith is profoundly anti-Biblical.
Yet you did complain that a “mandatory study of Biblicsl principles” had more of a place in schools than a major scientific theory which just happens to contradict your religious belief.
quote:
Of course no one here sees it as circular because they see common descent as factual, rather than a proposition in need of proper validation. It's not that either end of the circle is wrong, necessarily, it's that neither end is proven.
Nobody here sees it as circular since they aren’t desperate to dismiss evolution.
When it comes to genetics --- I agree with natural selection,
How is natural selection part of genetics? Is this just meaningless verbiage, or am I missing some actual point?
but I reject the notion that man has descended from some ancient creature (common descent theory).
Yep, he already said he's a YEC, but so what? This is a science discussion thread so he doesn't dictate that evidence is "out of bounds" because he doesn't believe the evidence, without any evidence supporting his personal opinion.
Anyway, any clues what he means in the top bit? Thanks, and good night!
Stop Tzar Vladimir the Condemned!
What if Eleanor Roosevelt had wings? -- Monty Python
One important characteristic of a theory is that it has survived repeated attempts to falsify it. Contrary to your understanding, all available evidence confirms it. --Subbie
If evolution is shown to be false, it will be at the hands of things that are true, not made up. --Percy
The reason that we have the scientific method is because common sense isn't reliable. -- Taq
Why should anyone debate someone who doesn't know the subject? -- AZPaul3
When it comes to genetics --- I agree with natural selection,
Well, genetics makes the thing and natural selection either kisses it or kills it.
I doubt very much if K understands the way natural selection works on a population's gene pool. He/she/it seems glued to the idea that evolution happens in individuals. This let's him/her/it throw smoke at that evil satan concept that so viciously pains him/her/it ... macroevolution.
™ Version 4.2
