|
|
Register | Sign In |
|
QuickSearch
| EvC Forum active members: 40 (9278 total) |
|
| |
| GraceAloneSaves | |
| Total: 923,471 Year: 213/3,580 Month: 213/212 Week: 65/58 Day: 17/16 Hour: 0/3 |
| Thread ▼ Details |
|
Thread Info
|
|
|
| Author | Topic: A test for claimed knowledge of how macroevolution occurs | |||||||||||||||||||||||||||||||||
Faith ![]() Suspended Member (Idle past 2110 days) Posts: 35298 From: Nevada, USA Joined: |
Can you explain why the genetic differences between species is irrelevant in your model? Don't the genetic differences between species explain the physical differences between species within your model? Differences between two unrelated species? You want to know why they are irrelevant? Isn't it obvious? To you they are related, that's why they aren't meaningless to you. The physical differences between species in my model might have an incidental interest, but it's your model that says they're genetically related, not mine.
|
|||||||||||||||||||||||||||||||||
Faith ![]() Suspended Member (Idle past 2110 days) Posts: 35298 From: Nevada, USA Joined: |
Why don't DNA sequences have any relevance in your model? Are you saying that your model can't explain anything about genetics? I said quite a bit about genetics in my post about the model. Did you miss it?
|
|||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10556 Joined: Member Rating: 7.1 |
Faith writes: Differences between two unrelated species? You want to know why they are irrelevant? Isn't it obvious? To you they are related, that's why they aren't meaningless to you. Why would the differences between genomes be irrelevant for two species that are not related?
The physical differences between species in my model might have an incidental interest, but it's your model that says they're genetically related, not mine. In your model, what causes a chimp to give birth to a chimp and not a human? Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?
|
|||||||||||||||||||||||||||||||||
|
Sarah Bellum Member (Idle past 1262 days) Posts: 826 Joined:
|
It appears that the original post of this thread says that something known to science isn't "really" known unless humans can duplicate it on a lab bench.
So things like plate tectonics and supernovae aren't really "scientific knowledge"?
|
|||||||||||||||||||||||||||||||||
Faith ![]() Suspended Member (Idle past 2110 days) Posts: 35298 From: Nevada, USA Joined: |
In your model, what causes a chimp to give birth to a chimp and not a human? It's got a chimp genome. Period.
Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon? \ It's got a chimp genome. Period.
|
|||||||||||||||||||||||||||||||||
|
PaulK Member Posts: 18367 Joined: Member Rating: 5.8
|
quote: That’s the problem. We have an observation crying out for explanation and your model has none. Ours does explain it.
quote: Ignoring evidence against your model by declaring it irrelevant is not exactly honest argument.
|
|||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10556 Joined: Member Rating: 7.1 |
Faith writes: It's got a chimp genome. Period. That's not what I asked. Please answer the question. In your model, what causes a chimp to give birth to a chimp and not a human? Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?
|
|||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10556 Joined: Member Rating: 7.1
|
Let's look at a vital human gene, cytochrome c.
Below are the two coding sequences for cytochrome c in humans and chimps.
Human ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACC
Chimp ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCATACC
******************************************************** ***
Human GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAG
Chimp GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTCGGGCGGAAG
************************************************** *********
Human ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
Chimp ACAGGTCAGGCCCCTGGATATTCTTACACGGCCGCCAATAAGAACAAAGGCATCATCTGG
******************** ******** ******************************
Human GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
Chimp GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
************************************************************
Human ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
Chimp ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
************************************************************
Human AAAGCTACTAATGAG
Chimp AAAGCTACTAATGAG
*************** So how does the creationist model explain how out of 315 bases there are just 4 that are different between human and chimp? Why should we see two separately created species with such similar DNA?
|
|||||||||||||||||||||||||||||||||
Faith ![]() Suspended Member (Idle past 2110 days) Posts: 35298 From: Nevada, USA Joined: |
In the creation model the question of the differences between chimp and human is utterly meaningless. The answer is the one I gave: the chimp gives birth to a chimp because it has a chimp genome. Human genetics has nothing to do with it. A chimp is a chimp, a human is a human.
Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||
Faith ![]() Suspended Member (Idle past 2110 days) Posts: 35298 From: Nevada, USA Joined: |
Similar design. Nothing else to say about it.
|
|||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10556 Joined: Member Rating: 7.1 |
Faith writes: In the creation model the question of the differences between chimp and human is utterly meaningless. Then the creation model can't model biology because genetic differences are a biological fact. If you can't explain what we see in genetics, then your model doesn't work. More to the point, the evolutionary model can explain all of this.
|
|||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10556 Joined: Member Rating: 7.1 |
Faith writes: Similar design. Did God start with a common design and make changes to it?
|
|||||||||||||||||||||||||||||||||
Faith ![]() Suspended Member (Idle past 2110 days) Posts: 35298 From: Nevada, USA Joined: |
Faith writes: Similar design. Did God start with a common design and make changes to it? No, each design is unique to the creature. Scripture puts human beings in a completely separate category from animals in any case.
|
|||||||||||||||||||||||||||||||||
Faith ![]() Suspended Member (Idle past 2110 days) Posts: 35298 From: Nevada, USA Joined: |
In the creation model the question of the differences between chimp and human is utterly meaningless. Then the creation model can't model biology because genetic differences are a biological fact. Um, the creation model is all about genetic differences. Chimp bodies and human bodies are identifiable by their genetic differences as well as by morphology. I keep trying to figure out your thinking but all I know is that you are so tightly bound up in the ToE you can't grasp what I'm saying no matter how I put it. I can try to say it again: The creation model certainly does model biology because it's all about genetic differences between the creatures.
If you can't explain what we see in genetics, then your model doesn't work. But creationism DOES explain what you see in genetics. I'm astonished at your not seeing it.
More to the point, the evolutionary model can explain all of this. So can the separate creation of each creature explain it. Edited by Faith, : No reason given. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||
|
Taq Member Posts: 10556 Joined: Member Rating: 7.1 |
Faith writes: No, each design is unique to the creature. Then why is 98% of the chimp genome identical to the human genome?
|
|||||||||||||||||||||||||||||||||
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2026
