A test for claimed knowledge of how macroevolution occurs

Differences between two unrelated species? You want to know why they are irrelevant? Isn't it obvious? To you they are related, that's why they aren't meaningless to you. The physical differences between species in my model might have an incidental interest, but it's your model that says they're genetically related, not mine.

I said quite a bit about genetics in my post about the model. Did you miss it?

Why would the differences between genomes be irrelevant for two species that are not related? In your model, what causes a chimp to give birth to a chimp and not a human? Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?

It appears that the original post of this thread says that something known to science isn't "really" known unless humans can duplicate it on a lab bench.So things like plate tectonics and supernovae aren't really "scientific knowledge"?

It's got a chimp genome. Period. \It's got a chimp genome. Period.

quote:

---

It's meaningless in my model.

---

That’s the problem. We have an observation crying out for explanation and your model has none. Ours does explain it.

quote:

---

There are all kinds of facts that can be ignored in contexts where they are irrelevant.

---

Ignoring evidence against your model by declaring it irrelevant is not exactly honest argument.

That's not what I asked. Please answer the question.In your model, what causes a chimp to give birth to a chimp and not a human? Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?

Let's look at a vital human gene, cytochrome c.Below are the two coding sequences for cytochrome c in humans and chimps.

Human                    ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACC
Chimp                    ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCATACC
                         ******************************************************** ***

Human                    GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAG
Chimp                    GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTCGGGCGGAAG
                         ************************************************** *********

Human                    ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
Chimp                    ACAGGTCAGGCCCCTGGATATTCTTACACGGCCGCCAATAAGAACAAAGGCATCATCTGG
                         ******************** ******** ******************************

Human                    GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
Chimp                    GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
                         ************************************************************

Human                    ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
Chimp                    ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
                         ************************************************************

Human                    AAAGCTACTAATGAG
Chimp                    AAAGCTACTAATGAG
                         ***************

So how does the creationist model explain how out of 315 bases there are just 4 that are different between human and chimp? Why should we see two separately created species with such similar DNA?

In the creation model the question of the differences between chimp and human is utterly meaningless. The answer is the one I gave: the chimp gives birth to a chimp because it has a chimp genome. Human genetics has nothing to do with it. A chimp is a chimp, a human is a human.Edited by Faith, : No reason given.

Similar design. Nothing else to say about it.

Then the creation model can't model biology because genetic differences are a biological fact. If you can't explain what we see in genetics, then your model doesn't work.More to the point, the evolutionary model can explain all of this.

Did God start with a common design and make changes to it?

No, each design is unique to the creature.Scripture puts human beings in a completely separate category from animals in any case.

Um, the creation model is all about genetic differences. Chimp bodies and human bodies are identifiable by their genetic differences as well as by morphology. I keep trying to figure out your thinking but all I know is that you are so tightly bound up in the ToE you can't grasp what I'm saying no matter how I put it.I can try to say it again: The creation model certainly does model biology because it's all about genetic differences between the creatures. But creationism DOES explain what you see in genetics. I'm astonished at your not seeing it. So can the separate creation of each creature explain it.Edited by Faith, : No reason given.Edited by Faith, : No reason given.

Then why is 98% of the chimp genome identical to the human genome?