|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 65 (9164 total) |
| |
ChatGPT | |
Total: 916,914 Year: 4,171/9,624 Month: 1,042/974 Week: 1/368 Day: 1/11 Hour: 0/0 |
Thread ▼ Details |
Thread Info
|
|
|
Author | Topic: Why is evolution so controversial? | |||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
Just for one minute, step back and take a overall picture.
Do you see what is driving these large divergence times? The big deal is the rate of mutation Indels rate of occurrence is slower than that of substitutions. Also the relevance of indels to human chimp divergence is only growing with new research. This is that perfect storm I mentioned way back in the posts. Regardless if you say I am misusing Nachman and Crowell’s paper. The trend is that Paleoanthropology and genetics are becoming more discordant with time. This is not supposed to happen with a healthy theory. It is evolution in decline.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
I am sure this is accurate for what genes this paper looked at. These numbers do vary from paper to paper according to the focus of the researchers. They looked at over 90% of the chimp genome, including the non-coding DNA. Their sequencing covered about 95% of the genome, if memory serves. Genes only make up about 3% of the genome. The chimp genome paper is the definitive paper for comparing the chimp genome to the human genome. Any subsequent papers will only be covering the 10% that they were not able to align with the human genome, or haplotypes within the chimp genome.
would say you can not get to 5% from 1.33% in these results. Like I say, different findings for different genes investigated. Here is a paper comparing different genes ( it covered exclusively chromosome 21 in humans and chromosome 22 in chimps) high-quality BAC clone sequences of the homologous chimpanzee chromosome 22 quote. I don't think you have a grasp of how much the chimp genome paper covered. "The draft genome assemblygenerated from ~3.6-fold sequence redundancy of the autosomes and ~1.8-fold redundancy of both sex chromosomescovers ~94% of the chimpanzee genome with >98% of the sequence in high-quality bases. "Initial sequence of the chimpanzee genome and comparison with the human genome | Nature Look at Table 1. They covered 2.7 billion bases. Initial sequence of the chimpanzee genome and comparison with the human genome | Nature They didn't look at a handful of genes or just a couple chromosomes. They sequenced nearly the entire genome and then compared it to the draft human genome which is even more complete than the chimp genome.
As I have stated over and over indel and substitution rates are addable/ As I stated earlier, they can only be added if they have the same units. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
The big deal is the rate of mutation Indels rate of occurrence is slower than that of substitutions. Also the relevance of indels to human chimp divergence is only growing with new research. The rate of mutation is not the same as the rate of bases changed. That's what you keep forgetting. Scientists have understood the relevance of indels for the entire time. No one is ignoring them, and no one has been ignoring them.
The trend is that Paleoanthropology and genetics are becoming more discordant with time. References?
|
|||||||||||||||||||||||||||||||||||||||
sfs Member (Idle past 2564 days) Posts: 464 From: Cambridge, MA USA Joined: |
quote:Which part of "largely complete" did you not understand? The paper looked at (nearly) the entire genome. quote:Which was nearly all of them. quote:Of course you can get to 5% -- provided you account for the size of the indels. But you've only been told that 10 or 20 times now, so I'm sure you're not going to understand it yet. In fact, this paper does say the difference is 5%. (Well, actually it says something more accurate than that, but let's try to stick to the simplest story here.) And no, it's not because of the genes that were investigated. (In fact, genes constitute only a tiny fraction of the genomes being compared.) quote:Incorrect calculations don't become correct by repeating them. quote:And as people who know far more about the subject than you do have replied over and over, you're wrong. I do wonder about the source of this idea that anybody's interpretation of a scientific paper is a valid as anybody else's. I wonder if some kind of misbegotten offspring of the protestant doctrine that everyone should be able to read and interpret scripture for themselves. I dunno. In any case, you're claiming to understand these papers better than their authors, which is kind of silly.
|
|||||||||||||||||||||||||||||||||||||||
sfs Member (Idle past 2564 days) Posts: 464 From: Cambridge, MA USA Joined: |
quote:In particular, the coding sequence of genes makes up less than 2% of the genome.
|
|||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 315 days) Posts: 16113 Joined: |
The trend is that Paleoanthropology and genetics are becoming more discordant with time. But since this is only happening in your head, it doesn't have the significance you wish to place on it.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
Just what I was looking for. thanks. With that in mind, let's see if this example sticks this time. Here are two sequences that differ by 1 indel.
seq A: AGTGTCT_____ACTATCCT seq B: AGTGTCTCCCCCACTATCCT The sequences differ by 5 bases. That is a 25% nucleotide difference out of the 20 bases in seq B. However, there is only 1 mutation, so the difference by number of mutations is 5% (if we count 1 mutation in 20 bases). Although sfs will probably correct me and point out that 5% is not technically correct, it should give you a feel for the difference between number of bases and number of mutations.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
In particular, the coding sequence of genes makes up less than 2% of the genome. I would even be wiling to add in RNA genes, upstream regulatory elements, and splicing sites. I could even be talked into 5% or even 10% of the genome that is under negative selection if we consider genes to be heritable units that factor into fitness. However, to come away with the impression that the chimp genome paper only covered a few genes . . . well, that's a bird of a different color. Luckily, zaius is here to clear up any misunderstandings you have about genetics. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: Look my friend not all the differences they found ended up in the percentage of autosomal variance. If they counted all divergence, humans and chimps would have a similarity less than 70%. About 700 million base pair did not even align at that time (that is .7/6.2 or about 11% of the two genomes). I have no problems with the findings except the same old 1.5% divergence (that is an interpretation). Face the fact that interpretive comparisons are a bit more than a cherry pick (especially this one). Let us talk about papers written after the initial sequencing back in 2005 for further new and hopefully more objective interpretation.
quote: So you will accept the initial sequencing interpretation over all subsequent papers? Sorry I do not
quote: And indels do the difference in mutations per site. (divergence in) Mutaions per site (k)/ mutations per site per generation (u) = generations t=.5(k/u-4Ne) which gives t the units of generation. Your argument is moot.
|
|||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 315 days) Posts: 16113 Joined:
|
The number of mutations, and the number of divergent bases, are not the same numbers.
This has been explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: Good count of mutations is (1) this gives (1) mutation per site. (k) = number of mutations different between species / number of sites In this case: Number of mutations = 1 Number of sites = 1 1/1 = 100% in this case. Now given 2 sites... Given 2 sites with 1 mutation. Number of mutations = 1 number of sites =2 percent divergence = 1/2 or 50%. Get it, Got it Mutations per site..
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
Look my friend not all the differences they found ended up in the percentage of autosomal variance. If they counted all divergence, humans and chimps would have a similarity less than 70%. About 700 million base pair did not even align at that time (that is .7/6.2 or about 11% of the two genomes). sfs can explain it much better than I can, but "not aligning" is not a synonym for "0% homology". If you don't know where the sequence fits in the chimp genome then you can't even compare it to the human genome to begin with. Therefore, you have no evidence that the unaligned sequence would have 0% homology. Even random sequence will have 25% homology.
I have no problems with the findings except the same old 1.5% divergence (that is an interpretation). Face the fact that interpretive comparisons are a bit more than a cherry pick (especially this one). Let us talk about papers written after the initial sequencing back in 2005 for further new and hopefully more objective interpretation. Any paper after 2005 will also be interpretations. Unless you can show us how the reported sequence in the 2005 paper is wrong, I don't see what objection you really have. They sequenced 94% of the genome. Do you really think the other 6% is going to be strikingly different?
And indels do the difference in mutations per site. The 5% number you keep using is in "bases changed". Therfore, they are not in the same units.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
Good post... Too early for cheers.
Well maybe not in your case... Cheers!
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
In this case: Number of mutations = 1 Number of sites = 1
In seq B there are 20 sites. Perhaps you want to try that again?
|
|||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 315 days) Posts: 16113 Joined:
|
Good post... Too early for cheers. Well maybe not in your case... Cheers! Thank you. So will you promise not to write anything so mindbogglingly stupid as this:
(divergence in) Mutaions per site (k) ... ever, ever again?
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024