Why is evolution so controversial?

how do you know the average generation is 20 years? chimps live for 35 years in the wild and reproduce at 12 years. And we don't know what the life cycles of our extinct ancestors where.

quote:

---

Well I guess you better notify Michael W. Nachman, and Susan L. Crowell that the units do not match in the equation they used for this paper. By the way do you know the units of (k) and (u)?

---

Go back and read the post immediately before yours. It gives the units, and also explains why Nachman and Crowell's equation is just fine for single-base substitutions. Think about it until you understand it.

quote:

---

k = is mutations (%)

---

Which is it? The number of mutations or the percentage difference? If you have two identical genomes, except that one of them has had an insertion mutation of 30 million base pairs, 1 out of 100 bases is different, but only 1 out of 3,000,000,000 sites has mutated. The mutation rate counts this as 1 event, while the percentage difference counts it as 30,000,000 differences. Counting the number of mutations is never going to get you to the percentage difference unless you know how big the mutations are.

quote:

---

Are you claiming interbreeding populations (by the way the populations at this point were relatively large) did not have a female female linage? That is what would have to happen again and again.

---

The population in question -- the people migrating out of Africa -- was small, and probably only a handful of matings between anatomically modern humans took place. Only about a third of the Neandertal genome is preserved in the descendants of those matings; there's no reason that mitochondrial DNA should be part of it.

quote:

---

You accuse me of having improbable mechanisms? That is total nonsense.

---

Show your work: given a plausible demographic model of the Out of Africa migration, and estimates for the amount of Neandertal admixture, calculate the probability that Neandertal mtDNA would have survived.

The problem is that since your value for k is the divergence between the genomes, then is not, in fact, "mutations (%)".This has been explained to you. And explained to you. And explained to you. They didn't make your mistake. This has also been explained to you. This is why they did a different calculation and got a different answer. This has been explained to you.Your mistake was passably interesting when you first made it. Watching you make it again and again and again is boring.Edited by Dr Adequate, : No reason given.

Hey man,Have you ever used LaTeX?Percy put the coding in so we could use it here. With it, you can change your paragraph into formulas. Check it out:
\\
and\\
\\
mean\ size\ of\ the\ mutation = {number\ of\ bases\ changed \over mutation}\\
\\
so\\
\\
mutation\ rate \times mean\ size\ of\ the\ mutation\ =\\
\\
{number\ of\ mutations \over {bp \times generation}} \times {number\ of\ bases\ changed \over mutation}\\
\\
\\
which\ gives\\
\\
\\
{number\ of\ bases\ changed \over {bp \times generation}}
\\
\\
Multiply\ that\ by\ the\ number\ of\ generations\ and\ you\ get\
\\
\\
k = {number\ of\ bases\ changed \over bp} [/latex]-->Its kind of a bitch to type all the coding out, but once its done it looks a lot better.Dontcha think?

Oh dear, not the most credible source, I'm afraid. Cherry-picked data and a confused blending of methods doesn't give a reliable estimate.I suggest you'd be rather better off reading the research of actual scientists rather than agenda-driven drivel of creationists.

quote:

---

Which is it? The number of mutations or the percentage difference?

---

Units are mutations and represent variance is percentage. Any way the mutation units (what ever they may be) are canceled in the first division.k/u leaves generation. (t) is in units of generation.

quote:

---

If you have two identical genomes, except that one of them has had an insertion mutation of 30 million base pairs, 1 out of 100 bases is different, but only 1 out of 3,000,000,000 sites has mutated. The mutation rate counts this as 1 event, while the percentage difference counts it as 30,000,000 differences.

---

OK let us count every site difference between the two genomes and see what percentage of variance comes up. The number is bp adjusted via alignment tool.

quote:

---

Counting the number of mutations is never going to get you to the percentage difference unless you know how big the mutations are.

---

Again bp is not completely counted, it is defiantly the adjusted percentage difference between the human chimp genome. Look, if you did a bruit force comparison between base pairs, human against chimp, the similarity of base pairs would be in the 65% range. You do not want to go there. So saying that all base pairs are accounted for in variance is just not true.I used to write algorithms for variance (not for biology). The alignment tools used in these comparisons adjust for distances and gaps and bp, in the genomes.

You are a agenda driven evolutionist and I am a faith driven creationist.

The units they are using do match since they are using number of mutations for both.

It is great far better than my chicken scratch. How do you get to the generation units of (t)?Remember:t = .5(k/u - 4Ne).Units of (u) cancel all units of (k) except the generation unit. Does your point even matter?My point may not be as pretty, but it carries more weight.

If that were so, then there would be no creationists since creationism is based purely on faith.

quote:

---

The units they are using do match since they are using number of mutations for both.

---

So am I....

And yet a fairly complete skull. Other places where we could look for intermediate traits would be in the hips, knees and feet, but having a full skull means a wealth of information is available. Curiously it is the cranium (skull) that shows a mix of differences between chimp and human traits -- an intermediate mosaic of traits -- from teeth to eyebrows to location of the spine connection. It falls into sequence with other fossils:It is before {B} in this diagram 29 Evidences for Macroevolution: Part 1{A} is a modern chimp, {B} is (B) Australopithecus africanus (STS 5), 2.6 My old.All those skulls except {A} have the same location of the spine to skull connection that shows upright posture and it is an adaptation that allows\facilitates bipedal locomotion.In between Sahelanthropus tchadensis and Australopithecus africanus we have three sets of fossils, starting with Orrorin tugenensis

quote:

---

Nickname: Millenium Man
Where Lived: Eastern Africa (Tugen Hills, central Kenya)
When Lived: Sometime between 6.2 and 5.8 million years ago

​

Living around 6 million years ago, Orrorin tugenensis is the one of the oldest early humans on our family tree. Individuals of this species were approximately the size of a chimpanzee and had small teeth with thick enamel, similar to modern humans. The most important fossil of this species is an upper femur, showing evidence of bone buildup typical of a biped - so Orrorin tugenensis individuals climbed trees but also probably walked upright with two legs on the ground.

---

Now we know that Australopithecus africanus (skull {B} above) was also able to climb trees and walk upright, so this is consilient with hominid evolution.We also have Ardipithecus kadabba:

quote:

---

Where Lived: Eastern Africa (Middle Awash Valley, Ethiopia)
When Lived: Between about 5.8 and 5.2 million years ago

​

Ardipithecus kadabba was bipedal (walked upright), probably similar in body and brain size to a modern chimpanzee, and had canines that resemble those in later hominins but that still project beyond the tooth row. This early human species is only known in the fossil record by a few post-cranial bones and sets of teeth. One bone from the large toe has a broad, robust appearance, suggesting its use in bipedal push-off.

---

And we have Ardipithecus ramidus:

quote:

---

Nickname: Ardi
Where Lived: Eastern Africa (Middle Awash and Gona, Ethiopia)
When Lived: About 4.4 million years ago

​

Ardipithecus ramidus was first reported in 1994; in 2009, scientists announced a partial skeleton, nicknamed ‘Ardi’. The foot bones in this skeleton indicate a divergent large toe combined with a rigid foot — it's still unclear what this means concerning bipedal behavior. The pelvis, reconstructed from a crushed specimen, is said to show adaptations that combine tree-climbing and bipedal activity. The discoverers argue that the ‘Ardi’ skeleton reflects a human-African ape common ancestor that was not chimpanzee-like. A good sample of canine teeth of this species indicates very little difference in size between males and females in this species.

​

Ardi’s fossils were found alongside faunal remains indicating she lived in a wooded environment. This contradicts the open savanna theory for the origin of bipedalism, which states that humans learned to walk upright as climates became drier and environments became more open and grassy.

---

And it is pretty clear (to me) that the ability to walk upright was an earlier adaptation to a mixed ecology. These lineages take the hominid family tree from present day back to the time for the common ancestor species and our divergence from chimpanzees. Their gradual changes in characteristics, where each group is intermediate between ones before and ones after show a clear trend fully explained by evolutionary processes.EnjoyEdited by RAZD, : clrty

quote:

---

If that were so, then there would be no creationists since creationism is based purely on faith.

---

And your faith in evolution takes more imagination than I could ever muster.

False. You are using two different sets of units: Mutations/generation and bases changed/generation. 1 mutation can change 1 or even 10,000 bases. Ok, let's do that:

seq A:  GCTTAGATTATTTCGAGATG
seq B:  GCTTAG_____TTCGAGATG

For a 20 base sequence, they differ by 5 bases for 75% identity. However, they only differ by 1 indel mutation. We get 25% for variance but 1 for mutation.