|
Register | Sign In |
|
QuickSearch
Thread ▼ Details |
Thread Info
|
|
|
Author | Topic: Why is evolution so controversial? | |||||||||||||||||||||||||||||||||||||||
frako Member (Idle past 336 days) Posts: 2932 From: slovenija Joined: |
and 20 years per generation The problem is where? how do you know the average generation is 20 years? chimps live for 35 years in the wild and reproduce at 12 years. And we don't know what the life cycles of our extinct ancestors where. Christianity, One woman's lie about an affair that got seriously out of hand What are the Christians gonna do to me ..... Forgive me, good luck with that.
|
|||||||||||||||||||||||||||||||||||||||
sfs Member (Idle past 2564 days) Posts: 464 From: Cambridge, MA USA Joined: |
quote:Go back and read the post immediately before yours. It gives the units, and also explains why Nachman and Crowell's equation is just fine for single-base substitutions. Think about it until you understand it. quote:Which is it? The number of mutations or the percentage difference? If you have two identical genomes, except that one of them has had an insertion mutation of 30 million base pairs, 1 out of 100 bases is different, but only 1 out of 3,000,000,000 sites has mutated. The mutation rate counts this as 1 event, while the percentage difference counts it as 30,000,000 differences. Counting the number of mutations is never going to get you to the percentage difference unless you know how big the mutations are.
|
|||||||||||||||||||||||||||||||||||||||
sfs Member (Idle past 2564 days) Posts: 464 From: Cambridge, MA USA Joined: |
quote:The population in question -- the people migrating out of Africa -- was small, and probably only a handful of matings between anatomically modern humans took place. Only about a third of the Neandertal genome is preserved in the descendants of those matings; there's no reason that mitochondrial DNA should be part of it. quote:Show your work: given a plausible demographic model of the Out of Africa migration, and estimates for the amount of Neandertal admixture, calculate the probability that Neandertal mtDNA would have survived.
|
|||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 315 days) Posts: 16113 Joined: |
The problem is where? The problem is that since your value for k is the divergence between the genomes, then is not, in fact, "mutations (%)". This has been explained to you. And explained to you. And explained to you.
Well I guess you better notify Michael W. Nachman, and Susan L. Crowell that the units do not match in the equation they used for this paper. They didn't make your mistake. This has also been explained to you. This is why they did a different calculation and got a different answer. This has been explained to you. Your mistake was passably interesting when you first made it. Watching you make it again and again and again is boring. Edited by Dr Adequate, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
New Cat's Eye Inactive Member
|
Multiply the mutation rate (= (number of mutations)/bp/generation) by the mean size of the mutation (= (number of bases changed)/mutation) and you'll get (number of bases changed)/bp/generation. Multiply that by the number of generations, and you've got k, the fraction of bases that differ (= (number of bases changed)/bp). For single-base substitutions, it doesn't matter, since it's 1 (base changed)/mutation. Hey man, Have you ever used LaTeX? Percy put the coding in so we could use it here. With it, you can change your paragraph into formulas. Check it out:
\\ and\\ \\ mean\ size\ of\ the\ mutation = {number\ of\ bases\ changed \over mutation}\\ \\ so\\ \\ mutation\ rate \times mean\ size\ of\ the\ mutation\ =\\ \\ {number\ of\ mutations \over {bp \times generation}} \times {number\ of\ bases\ changed \over mutation}\\ \\ \\ which\ gives\\ \\ \\ {number\ of\ bases\ changed \over {bp \times generation}} \\ \\ Multiply\ that\ by\ the\ number\ of\ generations\ and\ you\ get\ \\ \\ k = {number\ of\ bases\ changed \over bp} [/latex]--> Its kind of a bitch to type all the coding out, but once its done it looks a lot better. Dontcha think?
|
|||||||||||||||||||||||||||||||||||||||
Dr Jack Member Posts: 3514 From: Immigrant in the land of Deutsch Joined: Member Rating: 9.2 |
Oh dear, not the most credible source, I'm afraid. Cherry-picked data and a confused blending of methods doesn't give a reliable estimate.
I suggest you'd be rather better off reading the research of actual scientists rather than agenda-driven drivel of creationists.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: Units are mutations and represent variance is percentage. Any way the mutation units (what ever they may be) are canceled in the first division. k/u leaves generation. (t) is in units of generation.
quote: OK let us count every site difference between the two genomes and see what percentage of variance comes up. The number is bp adjusted via alignment tool.
quote: Again bp is not completely counted, it is defiantly the adjusted percentage difference between the human chimp genome. Look, if you did a bruit force comparison between base pairs, human against chimp, the similarity of base pairs would be in the 65% range. You do not want to go there. So saying that all base pairs are accounted for in variance is just not true. I used to write algorithms for variance (not for biology). The alignment tools used in these comparisons adjust for distances and gaps and bp, in the genomes.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
You are a agenda driven evolutionist and I am a faith driven creationist.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
Well I guess you better notify Michael W. Nachman, and Susan L. Crowell that the units do not match in the equation they used for this paper. The units they are using do match since they are using number of mutations for both.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
It is great far better than my chicken scratch. How do you get to the generation units of (t)?
Remember: t = .5(k/u - 4Ne). Units of (u) cancel all units of (k) except the generation unit. Does your point even matter? My point may not be as pretty, but it carries more weight.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
Keep in mind I am a narrow minded creationist who needs more proof than a speculation. If that were so, then there would be no creationists since creationism is based purely on faith.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: So am I....
|
|||||||||||||||||||||||||||||||||||||||
RAZD Member (Idle past 1435 days) Posts: 20714 From: the other end of the sidewalk Joined: |
Only cranial material? ... And yet a fairly complete skull. Other places where we could look for intermediate traits would be in the hips, knees and feet, but having a full skull means a wealth of information is available.
... Keep in mind I am a narrow minded creationist who needs more proof than a speculation. Curiously it is the cranium (skull) that shows a mix of differences between chimp and human traits -- an intermediate mosaic of traits -- from teeth to eyebrows to location of the spine connection. It falls into sequence with other fossils: It is before {B} in this diagram
{A} is a modern chimp, {B} is (B) Australopithecus africanus (STS 5), 2.6 My old. All those skulls except {A} have the same location of the spine to skull connection that shows upright posture and it is an adaptation that allows\facilitates bipedal locomotion. In between Sahelanthropus tchadensis and Australopithecus africanus we have three sets of fossils, starting with Orrorin tugenensis quote: Now we know that Australopithecus africanus (skull {B} above) was also able to climb trees and walk upright, so this is consilient with hominid evolution. We also have Ardipithecus kadabba:
quote: And we have Ardipithecus ramidus:
quote: And it is pretty clear (to me) that the ability to walk upright was an earlier adaptation to a mixed ecology. These lineages take the hominid family tree from present day back to the time for the common ancestor species and our divergence from chimpanzees. Their gradual changes in characteristics, where each group is intermediate between ones before and ones after show a clear trend fully explained by evolutionary processes. Enjoy Edited by RAZD, : clrtyby our ability to understand Rebel☮American☆Zen☯Deist ... to learn ... to think ... to live ... to laugh ... to share. Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click)
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: And your faith in evolution takes more imagination than I could ever muster.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
Units are mutations and represent variance is percentage. False. You are using two different sets of units: Mutations/generation and bases changed/generation. 1 mutation can change 1 or even 10,000 bases.
OK let us count every site difference between the two genomes and see what percentage of variance comes up. Ok, let's do that:
seq A: GCTTAGATTATTTCGAGATG seq B: GCTTAG_____TTCGAGATG For a 20 base sequence, they differ by 5 bases for 75% identity. However, they only differ by 1 indel mutation. We get 25% for variance but 1 for mutation.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024