|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 65 (9164 total) |
| |
ChatGPT | |
Total: 916,914 Year: 4,171/9,624 Month: 1,042/974 Week: 1/368 Day: 1/11 Hour: 0/1 |
Thread ▼ Details |
Thread Info
|
|
|
Author | Topic: Why is evolution so controversial? | |||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
Yes at the time the paper was accepted there was no controversy about mutation rates because indels were not in play, that is because they were not thought to affect protein coding. Then why do you use 5% in your calculations? If you use 5% then you are saying that all 5% were substitutions. The real number is 35 million substitutions and 5 million indels between both lineages, or 20 million total mutations per lineage. That is the real number. If you are using 5% of 3 billion, or 150 million mutations, then you are way off. "Here we present a draft genome sequence of the common chimpanzee (Pan troglodytes). Through comparison with the human genome, we have generated a largely complete catalogue of the genetic differences that have accumulated since the human and chimpanzee species diverged from our common ancestor, constituting approximately thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements."Initial sequence of the chimpanzee genome and comparison with the human genome | Nature Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
Dr Jack Member Posts: 3514 From: Immigrant in the land of Deutsch Joined: Member Rating: 9.2 |
It's worth noting at this point that there is no single and coherent definition of what the difference between two sequences is.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
It's worth noting at this point that there is no single and coherent definition of what the difference between two sequences is. The standard methods use parsimony as the guiding principle which means that the difference is the fewest mutations needed to to reconstruct the ancestral genome, if my understanding is accurate. The algorithms used for alignment may not be completely standardized, but I have yet to see massive differences between alignment methods that would allow for 5 or 10 fold differences in mutation rates. In other words, a 4 base gap in an alignment is assumed to be a single indel event of 4 bases in stead of 4 individual indel events. Zaius is treating a 4 base indel as 4 separate mutations. A point mutation is assumed to be a single change in one lineage instead of multiple mutations at the same base. Sequence that can not be aligned with strong confidence is kept out of the comparison. Edited by Taq, : No reason given. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
New Cat's Eye Inactive Member |
Yes at the time the paper was accepted there was no controversy about mutation rates What do you mean by controversy, and what is the point of mentioning it? Look, whatever the rate of mutation was, is what it was. It doesn't really matter what evidence we had a particular time, nor how confident we are in the changes to our understanding that we've uncovered. Regardless, you're going to want to use the most appropriate figure possible.
I can do the math. Yes, but you're using the wrong value for one of the variables. You've misunderstood what the variabe represents and have used the wrong data for it.
I really need a quote (in the literature) from you to back up your point. Nah, that's setting the bar too high. Just think about it, which is more likely:
So?
It has already been found that the necessary point mutations to reconcile a chimp human split at 5.6 million years is deficient by about half the needed mutations, since this paper was written. Calculated: 175 mutations per generation. Found empirically: 70 mutations. Obviously that calculation is way off. Why do you think that is? If its because you think that humans and chimps didn't evolve from a common ancestor, then from a scientific perspective: how the heck else did they get here?
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
5.6 million years is 244 thousand generations (given 23 years per generation). t= number of generations since divergence (244 thousand)k= percentage of sequence divergence Estimated at 5% Ne= effective size of population ~10^3 (u)= mutation rate needed. u= k/(2t+4Ne) or 9.5x10^-8 or ~ 600 mutations per generation (mutation rate times the diploid genome in humans).
If you are going to use indels, then you need to treat them as single mutations. 1.33% divergence is correct because 1.33% of 3E[9] is 39.9 million mutations, the total number of substitutions and indels added together. Also, you only have an effective population size of 1,000. That's way low. Most calculations use a minimum of 10,000, and many have 100,000. edit: mistakenly had 3E6 for human genome size before. Edited by Taq, : No reason given. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: Silly people Don’t believe everything you read at talkorigins.com Did you know that (r) the rate of natural increase is a unit less factor that auto adjusts environment, reproductive rates and food source (among other things). The value of accepted (r) is between .01 and .005 for humans. The plague in Europe and the world wars do affect the value of (r). Otherwise humans usually settle in environments conducive to their well being and reproductive benefit. Now lets look at the bunny N = ne^rtBiblical (r) prior to the plague = .007 to .01 I will use post plague and world wars for a value of (r) = .005 About the number of individuals around the year 2500 bc (scratch this, it is prior flood) If you use (r) = .005 from 4300 years ago and 8 individuals in the ark you get a population of 7 billion You know what is even sillier 10 thousand humans hanging around for 50,000 years with effective zero population growth. You know that long narrow bottleneck theory that is accepted in evolution dynamics. using (r) = .005 over 50,000 years with an initial population of 10 thousand you get (OOPs error overflow). My calculator does not display such large numbers. Now who’s proposition is sillier? Numbers don’t lie people do Edited by zaius137, : My error
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: I think that would be 1.33% x ~6.4 billion (remember diploid genome). Went back in my notes, I did use 10,000, just recorded wrong.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
I think that would be 1.33% x ~6.4 billion (remember diploid genome). For the number of mutations you use a haploid genome. You will notice in the chimp genome paper that they list the coverage as more than 90%, and the total number of bases sequenced as 2.7 billion bases. "The ARACHNE assembly has slightly greater continuity (Table 1) and was used for analysis in this paper. The draft genome assemblygenerated from ~3.6-fold sequence redundancy of the autosomes and ~1.8-fold redundancy of both sex chromosomescovers ~94% of the chimpanzee genome with >98% of the sequence in high-quality bases."Initial sequence of the chimpanzee genome and comparison with the human genome | Nature Here is a table showing the total number of bases sequenced: Initial sequence of the chimpanzee genome and comparison with the human genome | Nature The 40 million total mutations are referring to a 3 billion base haploid genome.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
Silly people Don’t believe everything you read at talkorigins.com Do you really think that the human population always grew at a set rate? Really? That's a completely unsupported assumption.
|
|||||||||||||||||||||||||||||||||||||||
Coyote Member (Idle past 2136 days) Posts: 6117 Joined:
|
You still have not answered the question:
What date do you put for the origin of modern humans? And upon what do you base your answer?Religious belief does not constitute scientific evidence, nor does it convey scientific knowledge. Belief gets in the way of learning--Robert A. Heinlein How can I possibly put a new idea into your heads, if I do not first remove your delusions?--Robert A. Heinlein It's not what we don't know that hurts, it's what we know that ain't so--Will Rogers If I am entitled to something, someone else is obliged to pay--Jerry Pournelle If a religion's teachings are true, then it should have nothing to fear from science...--dwise1 "Multiculturalism" does not include the American culture. That is what it is against.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
Just to make this clearer, here are two made up sequences
AAGTGTTACCGAGTCCATAAATGCCCC AAGTGTTA_____TCCATAAATGCCCC There are 27 bases in the top sequence. When we do an alignment with the bottom sequence we see a 5 base gap. This is a 5 base indel. Using parsimony, this would be considered a single 5 base indel event, a single mutation. However, the sequences only match at 20 of 27 bases. Therefore, they have~ 80% sequence identity at the base level. One mutation produces a 20% difference. This is why you can't use the difference in bases as a measurement of the number of mutations. Edited by Taq, : No reason given. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
Genomicus Member (Idle past 1972 days) Posts: 852 Joined: |
You still have not answered the question: What date do you put for the origin of modern humans? And upon what do you base your answer? I'm not quite sure if it's conducive to the clarity of this discussion to go off on slightly different topics/debating points, instead of focusing on the particular argument that he/she put forward. IMHO. Edited by Genomicus, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
Genomicus Member (Idle past 1972 days) Posts: 852 Joined: |
It's worth noting at this point that there is no single and coherent definition of what the difference between two sequences is. I'm a little confused on what you mean by this. The difference between two sequences can be quantified relatively easily as the number of differences in aligned base pairs + indels.
|
|||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 315 days) Posts: 16113 Joined: |
Did you know that (r) the rate of natural increase is a unit less factor that auto adjusts environment, reproductive rates and food source (among other things). This appears to be gibberish.
The value of accepted (r) is between .01 and .005 for humans. r is, obviously, not a constant.
Now who’s proposition is sillier? Well, your apparent belief that r can be taken to be constant is screaming twitching lunacy. That's a 10 on the silly scale.
Numbers don’t lie people do Sadly, creationists lie about numbers.
|
|||||||||||||||||||||||||||||||||||||||
Coyote Member (Idle past 2136 days) Posts: 6117 Joined:
|
You still have not answered the question: What date do you put for the origin of modern humans? And upon what do you base your answer? I'm not quite sure if it's conducive to the clarity of this discussion to go off on slightly different topics/debating points, instead of focusing on the particular argument that he/she put forward. IMHO. I disagree. If the poster will admit to a belief in modern humans coming into existence about 6,000 years ago, then we know that we can dismiss all of his arguments as being based on religion and being diametrically opposed to what science has found. That means we don't need to waste our time posting evidence, as no amount of evidence we post will make any difference. A date for modern humans about 6,000 years ago means that any and all discussions of the specifics of genetics by this poster will be based on beliefs, with no necessary relation to scientific evidence. Those posts will be apologetics, rather than science. I think this is an important point to establish. Likewise the poster thinks this is an important point to dodge, lest his whole approach be revealed.Religious belief does not constitute scientific evidence, nor does it convey scientific knowledge. Belief gets in the way of learning--Robert A. Heinlein How can I possibly put a new idea into your heads, if I do not first remove your delusions?--Robert A. Heinlein It's not what we don't know that hurts, it's what we know that ain't so--Will Rogers If I am entitled to something, someone else is obliged to pay--Jerry Pournelle If a religion's teachings are true, then it should have nothing to fear from science...--dwise1 "Multiculturalism" does not include the American culture. That is what it is against.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024