|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 64 (9164 total) |
| |
ChatGPT | |
Total: 916,784 Year: 4,041/9,624 Month: 912/974 Week: 239/286 Day: 46/109 Hour: 0/0 |
Thread ▼ Details |
Member (Idle past 4731 days) Posts: 283 From: Weed, California, USA Joined: |
Thread Info
|
|
|
Author | Topic: The Common Ancestor? | |||||||||||||||||||||||
Blue Jay Member (Idle past 2724 days) Posts: 2843 From: You couldn't pronounce it with your mouthparts Joined: |
Hi, Barbara.
barbara writes: I agree that "common ancestry" should not be used since it is too messy and it is based on speculation. The geographical environmental gene pool that defines a specific ecosystem is the primary initiator for evolution to take over for changes in appearances of the biota over time. That is a better explanation. Common ancestry means two organisms share an ancestor. Wherever there is reproduction, there is common ancestry.Wherever there is evolution, there is common ancestry between species. It's pretty simple, it isn't messy, and it isn't based on speculation. The only thing that's messy is identifying which organisms are common ancestors for which other organisms. -Bluejay (a.k.a. Mantis, Thylacosmilus) Darwin loves you.
|
|||||||||||||||||||||||
nwr Member Posts: 6411 From: Geneva, Illinois Joined: Member Rating: 4.9 |
Jon writes:
Usually, it is the most recent common ancestor that is of interest.
But this ape also has ancestors. Why stop at the ape? Why not keep going further back?
|
|||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
How do you know it was deleted if it is no longer there anymore? The same question for insertions, how do you know that it wasn't always there in a genome sequence? You can use a third species such as the gorilla. Even without a third species you can tell that DNA has either been deleted in one lineage or added in another because of the homology on either side of the indel. For example, below is a mock comparison of random sequence. Indels are marked by dashes:
Human AAATTGTTGCCG---ATGCCCCAGTTGT AAATTGTTGCCGTTCATGCCCCAGTTGT Chimp Whether the TTC was deleted in the human lineage or inserted in the chimp lineage can not be determined by this comparison alone which is why it is called an indel (insertion and deletion combined). However, if we add the gorilla sequence we can learn more:
Human AAATTGTTGCCG---ATGCCCCAGTTGT AAATTGTTGCCGTTCATGCCCCAGTTGT Chimp Gorilla AAATTGTTGCCG---ATGCCCCAGTTGT From this comparison we can determine that the TTC was inserted in the chimp lineage.
|
|||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
hat is on possible definition of species, but not comprehensive, and maybe not even accurate. The important concept here is gene flow. Whether or not two species can produce fertile offspring is not important. What is important is do they produce fertile offspring when given the chance. What we want to know is if mutations can flow freely from one population to the other. If not, then the populations are diverging. Of course, this definition only applies to living species who reproduce sexually. This doesn't apply to things such as fossil species or bacteria.
|
|||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
I agree that "common ancestry" should not be used since it is too messy and it is based on speculation. I disagree. The term "common ancestry" should be used correctly. Also, common ancestry is not based on speculation. It is based on evidence.
|
|||||||||||||||||||||||
Strongbow Junior Member (Idle past 4936 days) Posts: 26 Joined: |
quote: I agree, of course. In fact, I REALLY agree. But the point I was trying to make is that many creationists, or just the scientifically illiterate try to build arguments about precise, legalistic definitions of species.
|
|||||||||||||||||||||||
Jon Inactive Member |
A species is a bit like pornography... Really? Or are you just saying that because some judge dude did and you thought it'd be cool to repeat? Jon "Can we say the chair on the cat, for example? Or the basket in the person? No, we can't..." - Harriet J. Ottenheimer "Dim bulbs save on energy..." - jar
|
|||||||||||||||||||||||
Jon Inactive Member |
Indeed, and it is the time aspect that confuses me. How far back do we go to look for a common ancestor? What is recent? If we go back too far, then we risk getting something that is not representative of the population we want to examine (i.e., something that is not recent enough), but if we get too recent, we risk settling on a critter (since often our understanding of an entire species comes down to the remains of just a couple individuals) that may show a serious degree of interbreeding despite clear differentiations in the gene pools of the two populations - differentiations that clearly indicate a forming difference between the populations, but not one so severe as to prevent breeding.1 What degree of interbreeding and similarities/differences defines our cutoff?
I'm trying to understand how anthropologists decide what is and is not a common ancestor. Are there some critters which lie in a gray area? Perhaps a good way to help would be for an example. What is the agreed-upon most recent common ancestor - using the term cautiously - for humans and chimpanzees? I've seen some names thrown around here, but maybe we can look at the features and characteristics of these ancestors and compare them to present humans and chimps and ancestral humans and chimps to see how the common ancestor relates to both modern populations and to the populations of its daughter species "shortly after the lineages diverged" (to use phrasing by PaulK). Perhaps answering Tram's question will answer mine. Jon__________ 1 I, of course, understand the limits on our abilities to examine the DNA of a remain as old as the latest agreed-upon common ancestor. "Can we say the chair on the cat, for example? Or the basket in the person? No, we can't..." - Harriet J. Ottenheimer "Dim bulbs save on energy..." - jar
|
|||||||||||||||||||||||
nwr Member Posts: 6411 From: Geneva, Illinois Joined: Member Rating: 4.9 |
Jon writes:
I would guess that there is usually some uncertainty.I'm trying to understand how anthropologists decide what is and is not a common ancestor. Hopefully, somebody with more knowledge of the field will be able to comment.
|
|||||||||||||||||||||||
Strongbow Junior Member (Idle past 4936 days) Posts: 26 Joined: |
quote: Jeez...a little touchy eh? I meant only that it's sometimes difficult to draw a bright line between species, because it's more of a descriptive concept than a definitive set of criteria. In the same way , it's sometimes difficult to draw a bright line between provacative, but legitimate sexually-themed art and porno. If that's too hard to follow, consider language.... when did Old English become Middle English? When did Middle English become Elizabethan English? When did Elizabethan English morph into Modern English? The changes are slow, and gradual. I don't think you could define a date where everything before was one thing and everything after another. Species are quite similar in that respect.
|
|||||||||||||||||||||||
Strongbow Junior Member (Idle past 4936 days) Posts: 26 Joined: |
Common ERV's an excellent way to determine common ancestors, if DNA is available. They allow very detailed evolutionary relationships to be determined.
|
|||||||||||||||||||||||
Ken Fabos Member (Idle past 1266 days) Posts: 51 From: Australia Joined: |
How far back before we all share common ancestors is a genuine question, surely? Within a small population - as the foundation population of our species must have been - the number of generations further back to ancestors in common isn't far. Having a specific individual that all our species can count as an ancestor doesn't seem outrageous to me although it would only be found by studying our genome; finding the physical remains of that individual rather than the continually reproduced dna that came from them isn't going to happen. Isn't the reason a past species has appeared to be supplanted without intervening forms that evolution within groups isolated by geography and perhaps by territorial behaviour, results in more rapid differentiation than within big populations and when it produced traits that made for competitive success and the ability to colonise new territory, the diaspora of a new form (possibly not interfertile and thus species) followed. The prior intermediary forms occurred in relative isolation and in small overall numbers and most places simply don't suit successful fossilisation.
|
|||||||||||||||||||||||
Jon Inactive Member |
Having a specific individual that all our species can count as an ancestor doesn't seem outrageous to me It seems outrageous to me, and for good reason. Speciation does not show effects in single individuals. It takes an entire population breeding (gene swapping) back and forth generations to bring about changes that create new species out of old ones, and when it does, as the process should tell you, those new traits that can safely be clumped together as characteristics of a new species reside in the population at large, not a specific individual.
evolution within groups isolated by geography and perhaps by territorial behaviour, results in more rapid differentiation than within big populations Of course this is true, and it is true precisely because evolution works on populations, not individuals. Jon "Can we say the chair on the cat, for example? Or the basket in the person? No, we can't..." - Harriet J. Ottenheimer "Dim bulbs save on energy..." - jar
|
|||||||||||||||||||||||
Jon Inactive Member |
Easy. I agree with your statements. I just found your explanation funny.
Jon "Can we say the chair on the cat, for example? Or the basket in the person? No, we can't..." - Harriet J. Ottenheimer "Dim bulbs save on energy..." - jar
|
|||||||||||||||||||||||
barbara Member (Idle past 4828 days) Posts: 167 Joined: |
Thanks Taq, that makes sense.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024